Dataset for CDS classical BH3-containing proteins of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

19 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6NC45_PMAIP1-      at------------------------------------------------
A0A2K6NC45_PMAIP1-      at------------------------------------------------
A0A2K6QK74_BIK-01       at--------------------------gtctggagtaag----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6RAW8_BMF-02       atggagcca-------------------tctcggtgtgtggaggag----
A0A2K6RAW8_BMF-01       atggagcca-------------------tctcggtgtgtggaggag----
A0A2K6QZU4_BBC3-01      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
A0A2K6QZU4_BBC3-04      at------------------------------aaaatttggcgtggggtc
A0A2K6PUM5_BAD-01       atgttccaga------------------tcccagagtttga---------
A0A2K6PUM5_BAD-02       atgttccaga------------------tcccagagtttga---------

A0A2K6NC45_PMAIP1-      -----------------------------------gcctggaaagaaggc
A0A2K6NC45_PMAIP1-      -----------------------------------gcctggaaagaaggc
A0A2K6QK74_BIK-01       -----------------------------------acccg----------
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6RAW8_BMF-02       ---ctggaagatgatgtgttcca------------gccggaggacgggga
A0A2K6RAW8_BMF-01       ---ctggaagatgatgtgttcca------------gccggaggacgggga
A0A2K6QZU4_BBC3-01      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctcgg
A0A2K6QZU4_BBC3-04      tgcccggg------catgtccat------------gccaggtgcccaggg
A0A2K6PUM5_BAD-01       -----------------------------------gcctagtgagcagga
A0A2K6PUM5_BAD-02       -----------------------------------gcctagtgagcagga

A0A2K6NC45_PMAIP1-      -------------------------------------------gcgcaag
A0A2K6NC45_PMAIP1-      -------------------------------------------gcgcaag
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6RAW8_BMF-02       ---------------------------gccgggggcccaacctgggagct
A0A2K6RAW8_BMF-01       ---------------------------gccgggggcccaacctgggagct
A0A2K6QZU4_BBC3-01      cagtgtcctgcggcctctgcgagcccggcctggctgccacccccgctgcc
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K6PUM5_BAD-01       ---------------------------------------------agact
A0A2K6PUM5_BAD-02       ---------------------------------------------agact

A0A2K6NC45_PMAIP1-      aacgcgcaaccga-------------------------------------
A0A2K6NC45_PMAIP1-      aacgcgcaaccga-------------------------------------
A0A2K6QK74_BIK-01       -----tctccagagacatcttgatggagacc-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6RAW8_BMF-02       cgctctctgccgatctgtttgcccagagcctacttgactgccc-------
A0A2K6RAW8_BMF-01       cgctctctgccgatctgtttgcccagagcctacttgactgccc-------
A0A2K6QZU4_BBC3-01      cccgccctgctgc---------ccgctgcctacctctgcgcccccaccgc
A0A2K6QZU4_BBC3-04      -----------------------------cttcttctgcgac--------
A0A2K6PUM5_BAD-01       ccagctctgcaga---------gaggggcct-------------------
A0A2K6PUM5_BAD-02       ccagctctgcaga---------gaggggcct-------------------

A0A2K6NC45_PMAIP1-      ------------------------------gcccagcgcg----------
A0A2K6NC45_PMAIP1-      ------------------------------gcccagcgcg----------
A0A2K6QK74_BIK-01       ------------------------------ctcctgtatgagcag-----
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6RAW8_BMF-02       ------------------------------cctcagccgact--------
A0A2K6RAW8_BMF-01       ------------------------------cctcagccgact--------
A0A2K6QZU4_BBC3-01      cccacccgccgtcaccgccgccctggggggcccccgctggcctgggggtc
A0A2K6QZU4_BBC3-04      ------------------------gtgggtcccctgccagatttg-----
A0A2K6PUM5_BAD-01       ---------------------------gggccccagcccggcagggg---
A0A2K6PUM5_BAD-02       ---------------------------gggccccagcccggcagggg---
                                                         * *              

A0A2K6NC45_PMAIP1-      ----------------------------------ggctcagg--------
A0A2K6NC45_PMAIP1-      ----------------------------------ggctcagg--------
A0A2K6QK74_BIK-01       ----------------------------------ctcctggaacccctaa
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6RAW8_BMF-02       ------tcagctcttccctctcacccactgctgtggccctggccttcgac
A0A2K6RAW8_BMF-01       ------tcagctcttccctctcacccactgctgtggccctggccttcgac
A0A2K6QZU4_BBC3-01      cccgcagccggccccgaggcccacgcccggacg-gtcctcagccctcgct
A0A2K6QZU4_BBC3-04      -------------------------------tg-gtcctcagccctcgct
A0A2K6PUM5_BAD-01       ------acaggccctcagactccggcaagcatc-atcgccaggccccagg
A0A2K6PUM5_BAD-02       ------acaggccctcagactccggcaagcatc-atcgccaggccccagg

A0A2K6NC45_PMAIP1-      ----------------caggacctgcagggacggcaggga----------
A0A2K6NC45_PMAIP1-      ----------------cag-------------------------------
A0A2K6QK74_BIK-01       cc-------------atggaggttcttggtgtgactgaccc---------
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaag----------------------
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaag----------------------
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaaggtaatcccgaagacaatcacgg
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaaggtaatcccgaagacaatcacgg
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaaggtaatcccgaagacaatcacgg
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaaggtaatcccgaagacaatcacgg
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccaca------------------------
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaaggtaatcccgaagacaatcacgg
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaaggtaatcccgaagacaatcacgg
A0A2K6QIL2_BCL2L11      ctccct-----acagacagaaccacaaggtaatcccgaagacaatcacgg
A0A2K6RAW8_BMF-02       ccaccagccaggaagacaaggctacccagaccctcggcccagcctccccc
A0A2K6RAW8_BMF-01       ccaccagccaggaagacaaggctacccagaccctcggcccagcctccccc
A0A2K6QZU4_BBC3-01      ctcgctggcgga------gcagcacctggagtcgccggtgcccagcgccc
A0A2K6QZU4_BBC3-04      ctcgctggcgga------gcagcacctggagtcgccggtgcccagcgccc
A0A2K6PUM5_BAD-01       cctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagcc
A0A2K6PUM5_BAD-02       cctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagcc

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      agg-----------------------------------------------
A0A2K6QIL2_BCL2L11      agg-----------------------------------------------
A0A2K6QIL2_BCL2L11      agg-----------------------------------------------
A0A2K6QIL2_BCL2L11      agg-----------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      agg-----------------------------------------------
A0A2K6QIL2_BCL2L11      agg-----------------------------------------------
A0A2K6QIL2_BCL2L11      agg-----------------------------------------------
A0A2K6RAW8_BMF-02       agc-----------------------------------------------
A0A2K6RAW8_BMF-01       agc-----------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K6PUM5_BAD-01       atca----------------------------------------------
A0A2K6PUM5_BAD-02       atcatggagggagagcttggtattatcctgctgaatctgaggactctgaa

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-02       aatcccagtgcaaggatgctcgcggaagcatcagcagggatgtctgcccc

A0A2K6NC45_PMAIP1-      -----------------------------------------cggcgaggg
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       -----------------------------------------tgaagagga
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      -----------------------------------------tgaagggga
A0A2K6QIL2_BCL2L11      -----------------------------------------tgaagggga
A0A2K6QIL2_BCL2L11      -----------------------------------------tgaagggga
A0A2K6QIL2_BCL2L11      -----------------------------------------tgaagggga
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      -----------------------------------------tgaagggga
A0A2K6QIL2_BCL2L11      -----------------------------------------tgaagggga
A0A2K6QIL2_BCL2L11      -----------------------------------------tgaagggga
A0A2K6RAW8_BMF-02       -----------------------------------------caaggtgtt
A0A2K6RAW8_BMF-01       -----------------------------------------caaggtgtt
A0A2K6QZU4_BBC3-01      -----------------------------------------cgggg----
A0A2K6QZU4_BBC3-04      -----------------------------------------cgggg----
A0A2K6PUM5_BAD-01       -----------------------------------------tggag----
A0A2K6PUM5_BAD-02       agccactgactcagaagcccaactcgcagagaatgtaaagctggag----

A0A2K6NC45_PMAIP1-      accaagccggattagggattgggatgcagctgcatttcaccagaggcaaa
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       cctggaccctatggaggactt---cgatcctttggagtgtatggaggaca
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      cagctgcccccacggcagccctcagggcccgctggccccaccggccagcc
A0A2K6QIL2_BCL2L11      cagctgcccccacggcagccctcagggcccgctggccccaccggccagcc
A0A2K6QIL2_BCL2L11      cagctgcccccacggcagccctcagggcccgctggccccaccggccagcc
A0A2K6QIL2_BCL2L11      cagctgcccccacggcagccctcagggcccgctggccccaccggccagcc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      cagctgcccccacggcagccctcagggcccgctggccccaccggccagcc
A0A2K6QIL2_BCL2L11      cagctgcccccacggcagccctcagggcccgctggccccaccggccagcc
A0A2K6QIL2_BCL2L11      cagctgcccccacggcagccctcagggcccgctggccccaccggccagcc
A0A2K6RAW8_BMF-02       atgctgccttgtggggtaactgaggaaccc------------------ca
A0A2K6RAW8_BMF-01       atgctgccttgtggggtaactgaggaaccc------------------ca
A0A2K6QZU4_BBC3-01      -----gccctggcggg---cggtcccaccc------------------ag
A0A2K6QZU4_BBC3-04      -----gccctggcggg---cggtcccaccc------------------ag
A0A2K6PUM5_BAD-01       -----gcgctg--ggg---ctgtggagacc------------------cg
A0A2K6PUM5_BAD-02       -----gcgctg--ggg---ctgtggagacc------------------cg

A0A2K6NC45_PMAIP1-      aagctcctctcctcctcccc------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       gtgacatgttgg--------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ctggcccttttgctaccagatccccgcttttcatctttatgagaagatcc
A0A2K6QIL2_BCL2L11      ctggcccttttgctaccagatccccgcttttcatctttatgagaagatcc
A0A2K6QIL2_BCL2L11      ctggcccttttgctaccagatccccgcttttcatctttatgagaagatcc
A0A2K6QIL2_BCL2L11      ctggcccttttgctaccagatccccgcttttcatctttatgagaagatcc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ctggcccttttgctaccagatccccgcttttcatctttatgagaagatcc
A0A2K6QIL2_BCL2L11      ctggcccttttgctaccagatccccgcttttcatctttatgagaagatcc
A0A2K6QIL2_BCL2L11      ctggcccttttgctaccagatccccgcttttcatctttatgagaagatcc
A0A2K6RAW8_BMF-02       gcgactgttttatg------------------------------------
A0A2K6RAW8_BMF-01       gcgactgttttatggcaatgctggctaccggcttcctctccctgccagtt
A0A2K6QZU4_BBC3-01      gcggc---------------------------------------------
A0A2K6QZU4_BBC3-04      gcggc---------------------------------------------
A0A2K6PUM5_BAD-01       gagtc---------------------------------------------
A0A2K6PUM5_BAD-02       gagtc---------------------------------------------

A0A2K6NC45_PMAIP1-      -acttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagt
A0A2K6NC45_PMAIP1-      ----------------------------------------agctcgaagt
A0A2K6QK74_BIK-01       -ccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggc
A0A2K6QIL2_BCL2L11      -------------------------------------------------a
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      tccctgctgtctcgatcctccagtgggtatttctcttttgacac---aga
A0A2K6QIL2_BCL2L11      tccctgctgtctcgatcctccagtgggtatttctcttttgacac---aga
A0A2K6QIL2_BCL2L11      tccctgctgtctcgatcctccagtgggtatttctcttttgacac---aga
A0A2K6QIL2_BCL2L11      tccctgctgtctcgatcctccagtgggtatttctcttttgacac---aga
A0A2K6QIL2_BCL2L11      -----------------------------------------------aga
A0A2K6QIL2_BCL2L11      tccctgctgtctcgatcctccagtgggtatttctcttttgacac---aga
A0A2K6QIL2_BCL2L11      tccctgctgtctcgatcctccagtgggtatttctcttttgacac---aga
A0A2K6QIL2_BCL2L11      tccctgctgtctcgatcctccagtgggtatttctcttttgacac---aga
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       tcccggcagtcttgcccatcgggga-gcagccccccgaagggcagtggca
A0A2K6QZU4_BBC3-01      -cccggg------agtccgcgggga-ggaggaaca-gtgggcccgggaga
A0A2K6QZU4_BBC3-04      -cccggg------agtccgcgggga-ggaggaaca-gtgggcccgggaga
A0A2K6PUM5_BAD-01       -gccacagctcctaccccgcggggacggaggaggacgaagggatggagga
A0A2K6PUM5_BAD-02       -gccacagctcctaccccgcggggacggaggaggacgaagggatggagga

A0A2K6NC45_PMAIP1-      cgagtgtgctactcaactcaggagatttggagacaaactgaacttccggc
A0A2K6NC45_PMAIP1-      cgagtgtgctactcaactcaggagatttggagacaaactgaacttccggc
A0A2K6QK74_BIK-01       cccgcgcctggcccagctctctgaggtgg--------ccatgcacagcct
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      cagg-----agcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       acat-----cgagcagaggtacagattgcccgaaagcttcagtgcattgc
A0A2K6QZU4_BBC3-01      tcgg-----ggcccagctgcggcggatggcggacgacctcaacgcgcagt
A0A2K6QZU4_BBC3-04      tcgg-----ggcccagctgcggcggatggcggacgacctcaacgcgcagt
A0A2K6PUM5_BAD-01       --gg-----agcccagcccctttcggggccgctcgcgctccgcgccccct
A0A2K6PUM5_BAD-02       --gg-----agcccagcccctttcggggccgctcgcgctccgcgccccct

A0A2K6NC45_PMAIP1-      agaaacttttgaatct----------------------------------
A0A2K6NC45_PMAIP1-      agaaacttttgaatct----------------------------------
A0A2K6QK74_BIK-01       aggtctggctttcatctacgaccagaccgacgacatcagggatgttctta
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgc-----------
A0A2K6RAW8_BMF-02       ---------------------------------caccag-----------
A0A2K6RAW8_BMF-01       ag--accagttccaccggcttcatgtgcagcaacaccag-----------
A0A2K6QZU4_BBC3-01      a-------cgagcggcggagacaagaggagcagcagcga-----------
A0A2K6QZU4_BBC3-04      a-------cgagcggcggagacaagaggagcagcagcga-----------
A0A2K6PUM5_BAD-01       aa--cctctgggcagc----------------acagcga-----------
A0A2K6PUM5_BAD-02       aa--cctctgggcagc----------------acagcga-----------

A0A2K6NC45_PMAIP1-      -------gatagccaaactcttctgctca--ggaa-------------cc
A0A2K6NC45_PMAIP1-      -------gatagccaaactcttctgctca--ggaa-------------cc
A0A2K6QK74_BIK-01       caagtttcatggacggcttcaccacccttaaggagaacataatgaggttc
A0A2K6QIL2_BCL2L11      -------aatgg-------tagtcatcct--agaggatataggtgatact
A0A2K6QIL2_BCL2L11      --------------------------ctt--ccaggaggcaggctgaacc
A0A2K6QIL2_BCL2L11      -------aatgg--------------tt----------------------
A0A2K6QIL2_BCL2L11      -------aat----------------------------------------
A0A2K6QIL2_BCL2L11      -------aatgg--------------ctt--ccaggaggcaggctgaacc
A0A2K6QIL2_BCL2L11      -------aatgg--------------ctt--ccaggaggcaggctgaacc
A0A2K6QIL2_BCL2L11      -------aatgg--------------ctt--ccaggaggcaggctgaacc
A0A2K6QIL2_BCL2L11      -------aatgg--------------ctt--ccaggaggcaggctgaacc
A0A2K6QIL2_BCL2L11      -------aatgg--------------ctt--ccaggaggcaggctgaacc
A0A2K6QIL2_BCL2L11      -------aatgg--------------cta--actgg--------------
A0A2K6RAW8_BMF-02       -------cagaaccgaaatcgcgtgtggt--ggcagat------------
A0A2K6RAW8_BMF-01       -------cagaaccgaaatcgcgtgtggt--ggcagat------------
A0A2K6QZU4_BBC3-01      -------caccgc------ccctcgccct--ggagggt----------cc
A0A2K6QZU4_BBC3-04      -------caccgc------ccctcgccct--ggagggt----------cc
A0A2K6PUM5_BAD-01       -------tatggc------cgcgagctcc--ggaggatgagtgacgagtt
A0A2K6PUM5_BAD-02       -------tatggc------cgcgagctcc--ggaggatga----------

A0A2K6NC45_PMAIP1-      tgactgcatcaaaaacttg-------------------------------
A0A2K6NC45_PMAIP1-      tga-----------------------------------------------
A0A2K6QK74_BIK-01       tggagatccctgaatcccgggtcccaggtgtcccgcgaacaggtgctgct
A0A2K6QIL2_BCL2L11      t---cattgtgg----tttggatttatatttactggcttagatttgtat-
A0A2K6QIL2_BCL2L11      tgcagatatgcg----cccgga--gatacggatcgcccaagagttgcg--
A0A2K6QIL2_BCL2L11      -------------------aga--gaaatag-------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      tgcagatatgcg----cccgga--gatacggatcgcccaagagttgcg--
A0A2K6QIL2_BCL2L11      tgcagatatgcg----cccgga--gatacggatcgcccaagagttgcg--
A0A2K6QIL2_BCL2L11      tgcagatatgcg----cccgga--gatacggatcgcccaagagttgcg--
A0A2K6QIL2_BCL2L11      tgcagatatgcg----cccgga--gatacggatcgcccaagagttgcg--
A0A2K6QIL2_BCL2L11      tgcagatatgcg----cccgga--gatacggatcgcccaagagttgcg--
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW8_BMF-02       -----------------------cctcctcttc-----------------
A0A2K6RAW8_BMF-01       -----------------------cctcctcttc-----------------
A0A2K6QZU4_BBC3-01      tgtacaatctca----ttatgggactcctgccc-----------------
A0A2K6QZU4_BBC3-04      tgtacaatctca----ttatgggactcctgccc-----------------
A0A2K6PUM5_BAD-01       tgtggactcctt----taagggacttcctcgcccgaagagcgcgggtac-
A0A2K6PUM5_BAD-02       --------------------------------------------------

A0A2K6NC45_PMAIP1-      cataaggggactccaaacgagaatttttctcaggaggtgcacgtttcatc
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       ggcgctgctgctgctgctggcggcgctgctcagcgggggcctgcacctgc
A0A2K6QIL2_BCL2L11      gtggtttggatttatatttaccac------cacagtcaagataca-----
A0A2K6QIL2_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggaggttg-------
A0A2K6QIL2_BCL2L11      ----------------------------------aggaagttgtc-----
A0A2K6QIL2_BCL2L11      --------------------------------------gggtattttt--
A0A2K6QIL2_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggagggtattttt--
A0A2K6QIL2_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggagggtattttt--
A0A2K6QIL2_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggagggtattttt--
A0A2K6QIL2_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggaggatgtctcttc
A0A2K6QIL2_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggaggtt--------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW8_BMF-02       -------------ctgcacaaccttgcttt--------------------
A0A2K6RAW8_BMF-01       -------------ctgcacaaccttgcttt--------------------
A0A2K6QZU4_BBC3-01      --ttacccaggggccacagagccccc------------------------
A0A2K6QZU4_BBC3-04      --ttacccaggggccacagagccccc------------------------
A0A2K6PUM5_BAD-01       agcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcct
A0A2K6PUM5_BAD-02       --------------------------------------------------

A0A2K6NC45_PMAIP1-      aatttgaagaaagattgcattgtaattgg---------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       tgctcaagtga---------------------------------------
A0A2K6QIL2_BCL2L11      -----gaacaa-------------------ctcaaccacagggatttctc
A0A2K6QIL2_BCL2L11      -----gcaaaa---------------------------------------
A0A2K6QIL2_BCL2L11      -----gtgtag---------------------------------------
A0A2K6QIL2_BCL2L11      -----gaataa---------------------------------------
A0A2K6QIL2_BCL2L11      -----gaataattaccaagcagccgaagaacacccacaaatggttatctt
A0A2K6QIL2_BCL2L11      -----gaataattaccaagcagccgaagaacacccacaaatggttatctt
A0A2K6QIL2_BCL2L11      -----gaataattaccaagcagccgaagaacacccacaaatggttatctt
A0A2K6QIL2_BCL2L11      cacctgattaa---------------------------------------
A0A2K6QIL2_BCL2L11      -agagaaatag---------------------------------------
A0A2K6QIL2_BCL2L11      -----gactag---------------------------------------
A0A2K6RAW8_BMF-02       ----gaatggagaagagaatag----------------------------
A0A2K6RAW8_BMF-01       ----gaatggagaagagaataggaacggggcgggccctaggtga------
A0A2K6QZU4_BBC3-01      ----gaaatggagcccaattag----------------------------
A0A2K6QZU4_BBC3-04      ----gaaatggagcccaattag----------------------------
A0A2K6PUM5_BAD-01       ggtgggatcggaacttgggcaggggaagctccgccccctcccagtga---
A0A2K6PUM5_BAD-02       --------------------------------------------------

A0A2K6NC45_PMAIP1-      ----------------------------------------------
A0A2K6NC45_PMAIP1-      ----------------------------------------------
A0A2K6QK74_BIK-01       ----------------------------------------------
A0A2K6QIL2_BCL2L11      atga------------------------------------------
A0A2K6QIL2_BCL2L11      --------ctcctggcatcctccacctga-----------------
A0A2K6QIL2_BCL2L11      ----------------------------------------------
A0A2K6QIL2_BCL2L11      ----------------------------------------------
A0A2K6QIL2_BCL2L11      acgactgttgcgttacattgtccgcctggtgtggagaatgcattga
A0A2K6QIL2_BCL2L11      acgactgttgcgttacattgtccgcctggtgtggagaatgcattga
A0A2K6QIL2_BCL2L11      acgactgttgcgttacattgtccgcctggtgtggagaatgcattga
A0A2K6QIL2_BCL2L11      ----------------------------------------------
A0A2K6QIL2_BCL2L11      ----------------------------------------------
A0A2K6QIL2_BCL2L11      ----------------------------------------------
A0A2K6RAW8_BMF-02       ----------------------------------------------
A0A2K6RAW8_BMF-01       ----------------------------------------------
A0A2K6QZU4_BBC3-01      ----------------------------------------------
A0A2K6QZU4_BBC3-04      ----------------------------------------------
A0A2K6PUM5_BAD-01       ----------------------------------------------
A0A2K6PUM5_BAD-02       ----------------------------------------------

© 1998-2019