Dataset for CDS BMF of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6RAW8_BMF-01      atggagccatctcggtgtgtggaggagctggaagatgatgtgttccagcc
A0A2K6RAW8_BMF-02      atggagccatctcggtgtgtggaggagctggaagatgatgtgttccagcc
                       **************************************************

A0A2K6RAW8_BMF-01      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc
A0A2K6RAW8_BMF-02      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc
                       **************************************************

A0A2K6RAW8_BMF-01      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6RAW8_BMF-02      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
                       **************************************************

A0A2K6RAW8_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6RAW8_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A2K6RAW8_BMF-01      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6RAW8_BMF-02      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc
                       **************************************************

A0A2K6RAW8_BMF-01      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct
A0A2K6RAW8_BMF-02      tgccttgtggggtaactgaggaaccccagcgactgttttatg--------
                       ******************************************        

A0A2K6RAW8_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6RAW8_BMF-02      --------------------------------------------------
                                                                         

A0A2K6RAW8_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6RAW8_BMF-02      --------------------------------------------------
                                                                         

A0A2K6RAW8_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K6RAW8_BMF-02      --------------------------------------------------
                                                                         

A0A2K6RAW8_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6RAW8_BMF-02      ---caccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
                          ***********************************************

A0A2K6RAW8_BMF-01      gcacaaccttgctttgaatggagaagagaataggaacggggcgggcccta
A0A2K6RAW8_BMF-02      gcacaaccttgctttgaatggagaagagaatag-----------------
                       *********************************                 

A0A2K6RAW8_BMF-01      ggtga
A0A2K6RAW8_BMF-02      -----
                            

© 1998-2018