Dataset for CDS BCL2L11 of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6QIL2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaag--------------------------
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaag--------------------------
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIL2_BCL2L11      cctccctacagacagaaccaca----------------------------
                        **********************                            

A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6QIL2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6QIL2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6QIL2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6QIL2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6QIL2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6QIL2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6QIL2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6QIL2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6QIL2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6QIL2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6QIL2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6QIL2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6QIL2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6QIL2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6QIL2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6QIL2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6QIL2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6QIL2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6QIL2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6QIL2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6QIL2_BCL2L11      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6QIL2_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
A0A2K6QIL2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
                                                                          

A0A2K6QIL2_BCL2L11      tcctagaggatataggtgatactt---cattgtggtttggatttatattt
A0A2K6QIL2_BCL2L11      -cttccaggaggcaggctgaacctgcagatatgcgcccgga--gatacgg
A0A2K6QIL2_BCL2L11      -tt-----------------------------------aga--gaaatag
A0A2K6QIL2_BCL2L11      -ctaactgggactag-----------------------------------
A0A2K6QIL2_BCL2L11      -cttccaggaggcaggctgaacctgcagatatgcgcccgga--gatacgg
A0A2K6QIL2_BCL2L11      -cttccaggaggcaggctgaacctgcagatatgcgcccgga--gatacgg
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      -cttccaggaggcaggctgaacctgcagatatgcgcccgga--gatacgg
A0A2K6QIL2_BCL2L11      -cttccaggaggcaggctgaacctgcagatatgcgcccgga--gatacgg
A0A2K6QIL2_BCL2L11      -cttccaggaggcaggctgaacctgcagatatgcgcccgga--gatacgg
                                                                          

A0A2K6QIL2_BCL2L11      actggcttagatttgtatgtggtttggatttatatttaccac------ca
A0A2K6QIL2_BCL2L11      atcgcccaagagttgcg-gcgaatcggagacgagtttaacgcttactatg
A0A2K6QIL2_BCL2L11      a-------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      atcgcccaagagttgcg-gcgaatcggagacgagtttaacgcttactatg
A0A2K6QIL2_BCL2L11      atcgcccaagagttgcg-gcgaatcggagacgagtttaacgcttactatg
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      atcgcccaagagttgcg-gcgaatcggagacgagtttaacgcttactatg
A0A2K6QIL2_BCL2L11      atcgcccaagagttgcg-gcgaatcggagacgagtttaacgcttactatg
A0A2K6QIL2_BCL2L11      atcgcccaagagttgcg-gcgaatcggagacgagtttaacgcttactatg
                                                                          

A0A2K6QIL2_BCL2L11      cagtcaagata---cagaacaact--------------------------
A0A2K6QIL2_BCL2L11      caaggaggttg-----gcaaaact--------------------------
A0A2K6QIL2_BCL2L11      ------ggaagttgtcgtgtag----------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      caaggaggatgtctct----------------------------------
A0A2K6QIL2_BCL2L11      caaggaggtta-----gagaaatag-------------------------
A0A2K6QIL2_BCL2L11      ------gggtatttttgaataa----------------------------
A0A2K6QIL2_BCL2L11      caaggagggtatttttgaataattaccaagcagccgaagaacacccacaa
A0A2K6QIL2_BCL2L11      caaggagggtatttttgaataattaccaagcagccgaagaacacccacaa
A0A2K6QIL2_BCL2L11      caaggagggtatttttgaataattaccaagcagccgaagaacacccacaa
                                                                          

A0A2K6QIL2_BCL2L11      ------------------caaccacagggatttctcatga----------
A0A2K6QIL2_BCL2L11      ---------------------cctggcatcctccacctga----------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      -------------------------------tccacctg-----------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcctggtgtggagaat
A0A2K6QIL2_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcctggtgtggagaat
A0A2K6QIL2_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcctggtgtggagaat
                                                                          

A0A2K6QIL2_BCL2L11      -------
A0A2K6QIL2_BCL2L11      -------
A0A2K6QIL2_BCL2L11      -------
A0A2K6QIL2_BCL2L11      -------
A0A2K6QIL2_BCL2L11      --attaa
A0A2K6QIL2_BCL2L11      -------
A0A2K6QIL2_BCL2L11      -------
A0A2K6QIL2_BCL2L11      gcattga
A0A2K6QIL2_BCL2L11      gcattga
A0A2K6QIL2_BCL2L11      gcattga
                               

© 1998-2019