Dataset for CDS BBC3 of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6QZU4_BBC3-04      at------------------------------aaaatttggcgtggggtc
A0A2K6QZU4_BBC3-01      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
                        **                                *    *  * ***   

A0A2K6QZU4_BBC3-04      tgcccggg------catgtccat------------gccaggtgcccaggg
A0A2K6QZU4_BBC3-01      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctcgg
                         ***** *      *  * ** *            *** *******  **

A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K6QZU4_BBC3-01      cagtgtcctgcggcctctgcgagcccggcctggctgccacccccgctgcc

A0A2K6QZU4_BBC3-04      --------------------cttcttctgcgac-----------------
A0A2K6QZU4_BBC3-01      cccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgc
                                            ** * ****** *                 

A0A2K6QZU4_BBC3-04      ---------------gtgggtcccctgccagatttg--------------
A0A2K6QZU4_BBC3-01      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
                                       * *** **** **  *  * *              

A0A2K6QZU4_BBC3-04      ----------------------tggtcctcagccctcgctctcgctggcg
A0A2K6QZU4_BBC3-01      ggccccgaggcccacgcccggacggtcctcagccctcgctctcgctggcg

A0A2K6QZU4_BBC3-04      gagcagcacctggagtcgccggtgcccagcgccccgggggccctggcggg
A0A2K6QZU4_BBC3-01      gagcagcacctggagtcgccggtgcccagcgccccgggggccctggcggg

A0A2K6QZU4_BBC3-04      cggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
A0A2K6QZU4_BBC3-01      cggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg

A0A2K6QZU4_BBC3-04      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg
A0A2K6QZU4_BBC3-01      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg

A0A2K6QZU4_BBC3-04      cagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgcc
A0A2K6QZU4_BBC3-01      cagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgcc

A0A2K6QZU4_BBC3-04      ctggagggtcctgtacaatctcattatgggactcctgcccttacccaggg
A0A2K6QZU4_BBC3-01      ctggagggtcctgtacaatctcattatgggactcctgcccttacccaggg

A0A2K6QZU4_BBC3-04      gccacagagcccccgaaatggagcccaattag
A0A2K6QZU4_BBC3-01      gccacagagcccccgaaatggagcccaattag

© 1998-2019