Dataset for CDS classical BH3-containing proteins of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

19 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6KJF2_PMAIP1-      atg-----------------------------------------------
A0A2K6KJF2_PMAIP1-      atg-----------------------------------------------
A0A2K6MCW0_BIK-01       atg-----------------------tctggagtaagaccc-----gtct
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6L933_BMF-01       atggagcc----------------atctcggtgtgtg-----gagg----
A0A2K6L933_BMF-03       atggagcc----------------atctcggtgtgtg-----gagg----
A0A2K6L933_BMF-02       atggagcc----------------atctcggtgtgtg-----gagg----
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N1A1_BAD-02       atgttccag---------------atcccagagtttgagcctagtg----
A0A2K6N1A1_BAD-01       atgttccag---------------atcccagagtttgagcctagtg----

A0A2K6KJF2_PMAIP1-      ----------cctggaaagaaggcgcgc--------------------aa
A0A2K6KJF2_PMAIP1-      ----------cctggaaagaaggcgcgc--------------------aa
A0A2K6MCW0_BIK-01       ccagagacatcttgatggagaccctcctgtatgagcagctc---------
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccc-------cagctc--------a
A0A2K6L933_BMF-01       --------agctggaggatgatgtgttc-------cagccggaggacggg
A0A2K6L933_BMF-03       --------agctggaggatgatgtgttc-------cagccggaggacggg
A0A2K6L933_BMF-02       --------agctggaggatgatgtgttc-------cagccggaggacggg
A0A2K6KS56_BBC3-02      ----------ctggcgga-------gcg-------cacct---------g
A0A2K6N1A1_BAD-02       --------agcaggaaga-------ctc-------cagctctgcagagag
A0A2K6N1A1_BAD-01       --------agcaggaaga-------ctc-------cagctctgcagagag
                                  *  *                                    

A0A2K6KJF2_PMAIP1-      gaacgcgcaaccgagcccag-----------------------cgcggg-
A0A2K6KJF2_PMAIP1-      gaacgcgcaaccgagcccag-----------------------cgcggg-
A0A2K6MCW0_BIK-01       ---ctggaacccctaaccatggaggttcttggtgtgactgaccctgaaga
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaag-
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaag-
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaagg
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaagg
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccaca---
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaagg
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaagg
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaagg
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaagg
A0A2K6KJP8_BCL2L11      gacctggggcccctacctccctaca----------gacagaaccacaagg
A0A2K6L933_BMF-01       gagccgggggcccaacctgggag--------------------ctcgct-
A0A2K6L933_BMF-03       gagccgggggcccaacctgggag--------------------ctcgct-
A0A2K6L933_BMF-02       gagccgggggcccaacctgggag--------------------ctcgct-
A0A2K6KS56_BBC3-02      gagtcgcggtgccagccccg--------------------------ggg-
A0A2K6N1A1_BAD-02       gggcctgggccccagcccggcaggg----------gacaggccctcaga-
A0A2K6N1A1_BAD-01       gggcctgggccccagcccggcaggg----------gacaggccctcaga-
                                   *    *                                 

A0A2K6KJF2_PMAIP1-      ---ctcaggcaggacctgcagggacggcagggacggcgagggaccaagcc
A0A2K6KJF2_PMAIP1-      ---ctcaggcag--------------------------------------
A0A2K6MCW0_BIK-01       ggacctggac-------------------------------cctatggag
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      taatcccgaagacaatcacggaggtgaaggggacagctgcccccacggca
A0A2K6KJP8_BCL2L11      taatcccgaagacaatcacggaggtgaaggggacagctgcccccacggca
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      taatcccgaagacaatcacggaggtgaaggggacagctgcccccacggca
A0A2K6KJP8_BCL2L11      taatcccgaagacaatcacggaggtgaaggggacagctgcccccacggca
A0A2K6KJP8_BCL2L11      taatcccgaagacaatcacggaggtgaaggggacagctgcccccacggca
A0A2K6KJP8_BCL2L11      taatcccgaagacaatcacggaggtgaaggggacagctgcccccacggca
A0A2K6KJP8_BCL2L11      taatcccgaagacaatcacggaggtgaaggggacagctgcccccacggca
A0A2K6L933_BMF-01       ---ctctgccgatctgtttgcccagagcctacttgactgccccctcagcc
A0A2K6L933_BMF-03       ---ctctgccgatctgtttgcccagagcctacttgactgccccctcagcc
A0A2K6L933_BMF-02       ---ctctgccgatctgtttgcccagagcctacttgactgccccctcagcc
A0A2K6KS56_BBC3-02      ---ccctggc----------------------------------------
A0A2K6N1A1_BAD-02       ---ctccggcaa--------------------------gcatcatcgcca
A0A2K6N1A1_BAD-01       ---ctccggcaa--------------------------gcatcatcgcca

A0A2K6KJF2_PMAIP1-      ggattagggatt----------------------------gggatgcagc
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       gacttcgat-------------------------------cctttgg---
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      gccctcagggcc----------------------------cgctggcccc
A0A2K6KJP8_BCL2L11      gccctcagggcc----------------------------cgctggcccc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      gccctcagggcc----------------------------cgctggcccc
A0A2K6KJP8_BCL2L11      gccctcagggcc----------------------------cgctggcccc
A0A2K6KJP8_BCL2L11      gccctcagggcc----------------------------cgctggcccc
A0A2K6KJP8_BCL2L11      gccctcagggcc----------------------------cgctggcccc
A0A2K6KJP8_BCL2L11      gccctcagggcc----------------------------cgctggcccc
A0A2K6L933_BMF-01       gacttcagctcttccctctcacccactgctgtggccctggccttcgaccc
A0A2K6L933_BMF-03       gacttcagctcttccctctcacccactgctgtggccctggccttcgaccc
A0A2K6L933_BMF-02       gacttcagctcttccctctcacccactgctgtggccctggccttcgaccc
A0A2K6KS56_BBC3-02      ggccccgggagt----------------------------cgcgggg---
A0A2K6N1A1_BAD-02       ggccccaggcct----------------------------cctgtgggac
A0A2K6N1A1_BAD-01       ggccccaggcct----------------------------cctgtgggac

A0A2K6KJF2_PMAIP1-      tgcatttcaccagaggcaaaaagctcctctcctcctccccacttgccctt
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       ---agtgtatggaggacagtgacatgttggccctgcggctggcctgcatc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      accggcca---------------gccctggcccttttgctaccagatccc
A0A2K6KJP8_BCL2L11      accggcca---------------gccctggcccttttgctaccagatccc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      accggcca---------------gccctggcccttttgctaccagatccc
A0A2K6KJP8_BCL2L11      accggcca---------------gccctggcccttttgctaccagatccc
A0A2K6KJP8_BCL2L11      accggcca---------------gccctggcccttttgctaccagatccc
A0A2K6KJP8_BCL2L11      accggcca---------------gccctggcccttttgctaccagatccc
A0A2K6KJP8_BCL2L11      accggcca---------------gccctggcccttttgctaccagatccc
A0A2K6L933_BMF-01       accagcca--ggaagacaaggctacccagaccctcggcccagcctccccc
A0A2K6L933_BMF-03       accagcca--ggaagacaaggctacccagaccctcggcccagcctccccc
A0A2K6L933_BMF-02       accagcca--ggaagacaaggctacccagaccctcggcccagcctccccc
A0A2K6KS56_BBC3-02      ----------aggaggcgaagtgggccgg----------gaa--------
A0A2K6N1A1_BAD-02       gccagtcaccagcaggagcagccaaccag----------cagcagccatc
A0A2K6N1A1_BAD-01       gccagtcaccagcaggagcagccaaccag----------cagcagccatc

A0A2K6KJF2_PMAIP1-      c-------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       g-------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      c-------------------------------------------------
A0A2K6KJP8_BCL2L11      c-------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      c-------------------------------------------------
A0A2K6KJP8_BCL2L11      c-------------------------------------------------
A0A2K6KJP8_BCL2L11      c-------------------------------------------------
A0A2K6KJP8_BCL2L11      c-------------------------------------------------
A0A2K6KJP8_BCL2L11      c-------------------------------------------------
A0A2K6L933_BMF-01       a---------gccaaggtgttatgctgcct--tgtggggtaactgaggaa
A0A2K6L933_BMF-03       a---------gccaaggtgttatgctgcct--tgtggggtaactgaggaa
A0A2K6L933_BMF-02       a---------gccaaggtgttatgctgcct--tgtggggtaactgaggaa
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N1A1_BAD-02       atggagggagagcttggtattatcctgctgaatctgaggactctgaaaat
A0A2K6N1A1_BAD-01       a-------------------------------------------------

A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       -----------------gggatgagatggacgtgagcctcagggccccgc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      -gcttttcatctttatgagaagatcctccctgctgtctcgatcctccagt
A0A2K6KJP8_BCL2L11      -gcttttcatctttatgagaagatcctccctgctgtctcgatcctccagt
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      -gcttttcatctttatgagaagatcctccctgctgtctcgatcctccagt
A0A2K6KJP8_BCL2L11      -gcttttcatctttatgagaagatcctccctgctgtctcgatcctccagt
A0A2K6KJP8_BCL2L11      -gcttttcatctttatgagaagatcctccctgctgtctcgatcctccagt
A0A2K6KJP8_BCL2L11      -gcttttcatctttatgagaagatcctccctgctgtctcgatcctccagt
A0A2K6KJP8_BCL2L11      -gcttttcatctttatgagaagatcctccctgctgtctcgatcctccagt
A0A2K6L933_BMF-01       ccccagcgactgttttatggcaatgctggctaccggcttcctctccctgc
A0A2K6L933_BMF-03       ccccagcgactgttttatggcaatgctggctaccggcttcctctccctgc
A0A2K6L933_BMF-02       ccccagcgactgttttatggcaatgctggctaccggcttcctctccctgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N1A1_BAD-02       cccagtgcaaggatgctcgcggaagcatcagcagggatgtctgccccagc
A0A2K6N1A1_BAD-01       --------------------------------------------------

A0A2K6KJF2_PMAIP1-      -------------------------------------cgcggggccacga
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       gcct-----------------------ggcccagctctctgaggtgg---
A0A2K6KJP8_BCL2L11      ----------------------acaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      gggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      gggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      --------------------agacaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      gggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      gggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      gggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      gggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
A0A2K6KJP8_BCL2L11      gggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
A0A2K6L933_BMF-01       cagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagt
A0A2K6L933_BMF-03       cagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagt
A0A2K6L933_BMF-02       cagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagt
A0A2K6KS56_BBC3-02      --------------------------------------tcggggcccagc
A0A2K6N1A1_BAD-02       cactgactcagaagcccaactcgcagagaatgtaaagctggaggcgctgg
A0A2K6N1A1_BAD-01       --------------------------------------tggaggcgctgg

A0A2K6KJF2_PMAIP1-      ggaacaagtgcaagtagctcgaagtcgagtgtgctactc-----aactca
A0A2K6KJF2_PMAIP1-      ---------------agctcgaagtcgagtgtgctactc-----aactca
A0A2K6MCW0_BIK-01       -----ccatgca---cagcctaggtctggctttcatctacgaccagaccg
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6KJP8_BCL2L11      caaatcaacaca---aaccccaagtcctccttgccaggccttcaaccact
A0A2K6L933_BMF-01       gg---caacatc---gagcagaggtacagattgcccgaa-----agcttc
A0A2K6L933_BMF-03       gg---caacatc---gagcagaggtacagattgcccgaa-----agcttc
A0A2K6L933_BMF-02       gg---caacatc---gagcagaggtacagattgcccgaa-----agcttc
A0A2K6KS56_BBC3-02      tg---cggcgga---tggc--gaga--------cgactc-----aac---
A0A2K6N1A1_BAD-02       gg---ctgtgga---gacccggagt--------cgccac-----agctcc
A0A2K6N1A1_BAD-01       gg---ctgtgga---gacccggagt--------cgccac-----agctcc

A0A2K6KJF2_PMAIP1-      ggagatttggag------------------acaaactgaacttccggcag
A0A2K6KJF2_PMAIP1-      ggagatttggag------------------acaaactgaacttccggcag
A0A2K6MCW0_BIK-01       acgacatcagggatgttctt----------acaagtttcatggacggctt
A0A2K6KJP8_BCL2L11      atctcagtgcaatggtagtcatcct-----agaggatataggtgatactt
A0A2K6KJP8_BCL2L11      ----------------------ctt-----ccaggaggcaggctgaacct
A0A2K6KJP8_BCL2L11      atctcagtgcaatgg-------tt--------------------------
A0A2K6KJP8_BCL2L11      atctcagtgcaat-------------------------------------
A0A2K6KJP8_BCL2L11      atctcagtgcaatgg-------ctt-----ccaggaggcaggctgaacct
A0A2K6KJP8_BCL2L11      atctcagtgcaatgg-------ctt-----ccaggaggcaggctgaacct
A0A2K6KJP8_BCL2L11      atctcagtgcaatgg-------ctt-----ccaggaggcaggctgaacct
A0A2K6KJP8_BCL2L11      atctcagtgcaatgg-------ctt-----ccaggaggcaggctgaacct
A0A2K6KJP8_BCL2L11      atctcagtgcaatgg-------ctt-----ccaggaggcaggctgaacct
A0A2K6KJP8_BCL2L11      atctcagtgcaatgg-------cta-----actgg---------------
A0A2K6L933_BMF-01       agtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcag
A0A2K6L933_BMF-03       agtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcag
A0A2K6L933_BMF-02       agtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcag
A0A2K6KS56_BBC3-02      -gcgcagtacagacggcgga-gaca-----agagga-gcagcagcgacac
A0A2K6N1A1_BAD-02       taccccgcggggacggaggaggacg-----aagggatggaggaggagccc
A0A2K6N1A1_BAD-01       taccccgcggggacggaggaggacg-----aagggatggaggaggagccc

A0A2K6KJF2_PMAIP1-      aaacttttgaatctg----atagccaaactcttctgctcagga-------
A0A2K6KJF2_PMAIP1-      aaacttttgaatctg----atagccaaactcttctgctcagga-------
A0A2K6MCW0_BIK-01       caccaccctta--------aggagaacataatgaggttctggagatccct
A0A2K6KJP8_BCL2L11      ---cattgtggtttggatttatatttactggcttagatttgtatgtggtt
A0A2K6KJP8_BCL2L11      gcagatatgcgcccgga--gatacggatcgcccaagagttgcg-gcgaat
A0A2K6KJP8_BCL2L11      --------------aga--gaaatag------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      gcagatatgcgcccgga--gatacggatcgcccaagagttgcg-gcgaat
A0A2K6KJP8_BCL2L11      gcagatatgcgcccgga--gatacggatcgcccaagagttgcg-gcgaat
A0A2K6KJP8_BCL2L11      gcagatatgcgcccgga--gatacggatcgcccaagagttgcg-gcgaat
A0A2K6KJP8_BCL2L11      gcagatatgcgcccgga--gatacggatcgcccaagagttgcg-gcgaat
A0A2K6KJP8_BCL2L11      gcagatatgcgcccgga--gatacggatcgcccaagagttgcg-gcgaat
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L933_BMF-01       aaccgaaatcgcgtgtg--gtggcagatcctcctcttcctgca-------
A0A2K6L933_BMF-03       aaccgaaatcgcgtgtg--gtggcagatcctcctcttcctgca-------
A0A2K6L933_BMF-02       aaccgaaatcgcgtgtg--gtggcagatcctcctcttcctgca-------
A0A2K6KS56_BBC3-02      cgcccctcgccctggag--ggtcctgtacaatctcattatggg-------
A0A2K6N1A1_BAD-02       agcccctttc------g--gggc-----cgctcgcgctccgcg-------
A0A2K6N1A1_BAD-01       agcccctttc------g--gggc-----cgctcgcgctccgcg-------

A0A2K6KJF2_PMAIP1-      ---------------acctgactgcatcaaaaacttgcataaggggactc
A0A2K6KJF2_PMAIP1-      ---------------acctga-----------------------------
A0A2K6MCW0_BIK-01       gaatcccgggtcccaggtgtcccgcgaacaggtgctgc-----------t
A0A2K6KJP8_BCL2L11      tggatttatatttaccac------cacagtcaagataca----------g
A0A2K6KJP8_BCL2L11      cggagacgagtttaacgcttactatgcaaggaggttg------------g
A0A2K6KJP8_BCL2L11      ----------------------------aggaagttgtc----------g
A0A2K6KJP8_BCL2L11      --------------------------------gggtattttt-------g
A0A2K6KJP8_BCL2L11      cggagacgagtttaacgcttactatgcaaggagggtattttt-------g
A0A2K6KJP8_BCL2L11      cggagacgagtttaacgcttactatgcaaggagggtattttt-------g
A0A2K6KJP8_BCL2L11      cggagacgagtttaacgcttactatgcaaggagggtattttt-------g
A0A2K6KJP8_BCL2L11      cggagacgagtttaacgcttactatgcaaggaggatgtctcttccacctg
A0A2K6KJP8_BCL2L11      cggagacgagtttaacgcttactatgcaaggaggtt---------agaga
A0A2K6KJP8_BCL2L11      -------------------------------------------------g
A0A2K6L933_BMF-01       -------------caaccttgctttgaatggaga---------------a
A0A2K6L933_BMF-03       -------------caaccttgctttgaatggaga---------------a
A0A2K6L933_BMF-02       -------------caaccttgctttgaatggaga---------------a
A0A2K6KS56_BBC3-02      -------------actcctgcccttacccagggg---------------c
A0A2K6N1A1_BAD-02       -------------ccccctaacct---ctgggca---------------g
A0A2K6N1A1_BAD-01       -------------ccccctaacct---ctgggca---------------g

A0A2K6KJF2_PMAIP1-      caaacgagaatttttctcaggaggtgcacgtttcatcaatttgaagaaag
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       ggcgctgctgctgctgctggcggcgctgctcagcgggggcctgc------
A0A2K6KJP8_BCL2L11      aacaa-------------------ctcaaccacagggatttctcatga--
A0A2K6KJP8_BCL2L11      caaaa---------------------------------------------
A0A2K6KJP8_BCL2L11      tgtag---------------------------------------------
A0A2K6KJP8_BCL2L11      aataa---------------------------------------------
A0A2K6KJP8_BCL2L11      aataattaccaagcagccgaagaccacccacaaatggttatcttacgact
A0A2K6KJP8_BCL2L11      aataattaccaagcagccgaagaccacccacaaatggttatcttacgact
A0A2K6KJP8_BCL2L11      aataattaccaagcagccgaagaccacccacaaatggttatcttacgact
A0A2K6KJP8_BCL2L11      attaa---------------------------------------------
A0A2K6KJP8_BCL2L11      aatag---------------------------------------------
A0A2K6KJP8_BCL2L11      actag---------------------------------------------
A0A2K6L933_BMF-01       gagaataggaacggggcgggccctag------------------------
A0A2K6L933_BMF-03       gagaataggaacggggcgggccctag------------------------
A0A2K6L933_BMF-02       gagaataggaacggggcgggccctaggcccttgacctggaatgggggccg
A0A2K6KS56_BBC3-02      caca-------------gagcccccg-----------aaatgga------
A0A2K6N1A1_BAD-02       cacagcgatatggccgcgagctccgg-----------aggatga------
A0A2K6N1A1_BAD-01       cacagcgatatggccgcgagctccgg-----------aggatgagtgacg

A0A2K6KJF2_PMAIP1-      attgcattgtaattgg----------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       -----------------------acctgctgctcaagtga----------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --cttctggcatcctccacctga---------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      gttgcgttacattgtccgcctggtgtggagaatgcattga----------
A0A2K6KJP8_BCL2L11      gttgcgttacattgtccgcctggtgtggagaatgcattga----------
A0A2K6KJP8_BCL2L11      gttgcgttacattgtccgcctggtgtggagaatgcattga----------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L933_BMF-01       ------------------------------------gtga----------
A0A2K6L933_BMF-03       ------------------------------------gtga----------
A0A2K6L933_BMF-02       ttgtcaaacactgttgaaggggaggctgatgtgtctgtga----------
A0A2K6KS56_BBC3-02      ------------------------------gcccaattag----------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-01       agtttgtggactcctttaagggacttcctcgcccgaagagcgcgggcaca

A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-01       gcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctg

A0A2K6KJF2_PMAIP1-      ----------------------------------------------
A0A2K6KJF2_PMAIP1-      ----------------------------------------------
A0A2K6MCW0_BIK-01       ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6KJP8_BCL2L11      ----------------------------------------------
A0A2K6L933_BMF-01       ----------------------------------------------
A0A2K6L933_BMF-03       ----------------------------------------------
A0A2K6L933_BMF-02       ----------------------------------------------
A0A2K6KS56_BBC3-02      ----------------------------------------------
A0A2K6N1A1_BAD-02       ----------------------------------------------
A0A2K6N1A1_BAD-01       gtgggatcggaacttgggcaggggaagctccgccccctcccagtga

© 1998-2019