Dataset for CDS BMF of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6L933_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6L933_BMF-03      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6L933_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A2K6L933_BMF-01      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc
A0A2K6L933_BMF-03      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc
A0A2K6L933_BMF-02      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc
                       **************************************************

A0A2K6L933_BMF-01      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6L933_BMF-03      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6L933_BMF-02      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
                       **************************************************

A0A2K6L933_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6L933_BMF-03      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6L933_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A2K6L933_BMF-01      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6L933_BMF-03      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6L933_BMF-02      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc
                       **************************************************

A0A2K6L933_BMF-01      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct
A0A2K6L933_BMF-03      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct
A0A2K6L933_BMF-02      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct
                       **************************************************

A0A2K6L933_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6L933_BMF-03      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6L933_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
                       **************************************************

A0A2K6L933_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6L933_BMF-03      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6L933_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
                       **************************************************

A0A2K6L933_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K6L933_BMF-03      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K6L933_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
                       **************************************************

A0A2K6L933_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6L933_BMF-03      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6L933_BMF-02      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
                       **************************************************

A0A2K6L933_BMF-01      gcacaaccttgctttgaatggagaagagaataggaacggggcgggcccta
A0A2K6L933_BMF-03      gcacaaccttgctttgaatggagaagagaataggaacggggcgggcccta
A0A2K6L933_BMF-02      gcacaaccttgctttgaatggagaagagaataggaacggggcgggcccta
                       **************************************************

A0A2K6L933_BMF-01      g-------------------------------------------------
A0A2K6L933_BMF-03      g-------------------------------------------------
A0A2K6L933_BMF-02      ggcccttgacctggaatgggggccgttgtcaaacactgttgaaggggagg
                       *                                                 

A0A2K6L933_BMF-01      -----------gtga
A0A2K6L933_BMF-03      -----------gtga
A0A2K6L933_BMF-02      ctgatgtgtctgtga
                                  ****

© 1998-2018