Dataset for CDS BAD of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6N1A1_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K6N1A1_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
                       **************************************************

A0A2K6N1A1_BAD-01      tgcagagaggggcctgggccccagcccggcaggggacaggccctcagact
A0A2K6N1A1_BAD-02      tgcagagaggggcctgggccccagcccggcaggggacaggccctcagact
                       **************************************************

A0A2K6N1A1_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K6N1A1_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
                       **************************************************

A0A2K6N1A1_BAD-01      cagcaggagcagccaaccagcagcagccatca------------------
A0A2K6N1A1_BAD-02      cagcaggagcagccaaccagcagcagccatcatggagggagagcttggta
                       ********************************                  

A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-02      ttatcctgctgaatctgaggactctgaaaatcccagtgcaaggatgctcg
                                                                         

A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-02      cggaagcatcagcagggatgtctgccccagccactgactcagaagcccaa
                                                                         

A0A2K6N1A1_BAD-01      -------------------tggaggcgctggggctgtggagacccggagt
A0A2K6N1A1_BAD-02      ctcgcagagaatgtaaagctggaggcgctggggctgtggagacccggagt
                                          *******************************

A0A2K6N1A1_BAD-01      cgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
A0A2K6N1A1_BAD-02      cgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
                       **************************************************

A0A2K6N1A1_BAD-01      ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctct
A0A2K6N1A1_BAD-02      ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctct
                       **************************************************

A0A2K6N1A1_BAD-01      gggcagcacagcgatatggccgcgagctccggaggatgagtgacgagttt
A0A2K6N1A1_BAD-02      gggcagcacagcgatatggccgcgagctccggaggatga-----------
                       ***************************************           

A0A2K6N1A1_BAD-01      gtggactcctttaagggacttcctcgcccgaagagcgcgggcacagcgac
A0A2K6N1A1_BAD-02      --------------------------------------------------
                                                                         

A0A2K6N1A1_BAD-01      gcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtggg
A0A2K6N1A1_BAD-02      --------------------------------------------------
                                                                         

A0A2K6N1A1_BAD-01      atcggaacttgggcaggggaagctccgccccctcccagtga
A0A2K6N1A1_BAD-02      -----------------------------------------
                                                                

© 1998-2018