Dataset for CDS BCL2L11 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O88498_BCL2L11-01      atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtgg
O88498_BCL2L11-02      atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtgg
                       **************************************************

O88498_BCL2L11-01      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
O88498_BCL2L11-02      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
                       **************************************************

O88498_BCL2L11-01      cctccctacagacagaatcgcaaggtaatcccgacggcgaaggggaccgc
O88498_BCL2L11-02      cctccctacagacagaatcgca----------------------------
                       **********************                            

O88498_BCL2L11-01      tgcccccacggcagccctcagggcccgctggccccaccggccagccctgg
O88498_BCL2L11-02      --------------------------------------------------
                                                                         

O88498_BCL2L11-01      tccttttgctaccagatccccacttttcatctttgtgagaagatcttctc
O88498_BCL2L11-02      --------------------------------------------------
                                                                         

O88498_BCL2L11-01      tgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagc
O88498_BCL2L11-02      ----------------------------------------agacaggagc
                                                               **********

O88498_BCL2L11-01      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
O88498_BCL2L11-02      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
                       **************************************************

O88498_BCL2L11-01      ccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctc
O88498_BCL2L11-02      ccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctc
                       **************************************************

O88498_BCL2L11-01      aggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctg
O88498_BCL2L11-02      aggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctg
                       **************************************************

O88498_BCL2L11-01      cggcggatcggagacgagttcaatgagacttacacgaggagggcgtttgc
O88498_BCL2L11-02      cggcggatcggagacgagttcaatgagacttacacgaggagggcgtttgc
                       **************************************************

O88498_BCL2L11-01      aaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaac
O88498_BCL2L11-02      aaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaac
                       **************************************************

O88498_BCL2L11-01      tgttacgattcatcttccgtctggtctggagaaggcactga
O88498_BCL2L11-02      tgttacgattcatcttccgtctggtctggagaaggcactga
                       *****************************************

© 1998-2018