Dataset for CDS classical BH3-containing proteins of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      cttctgtccgccagaaaagctcgtttcagtgtttgcccgtgttcttctcc
A0A3B4BVX1_BCL2L11      ---atgtcca----------------------------------------
A0A3B4CNJ8_BMF-01       ------------------------------atgga---------------
A0A3B4CPH6_BAD-01       ------------------------------atggctcat--atgttcaca
A0A3B4DUY7_BAD-01       ------------------------------atgagcaatcaatatctgca
                                                                          

A0A3B4BVX1_BCL2L11      ---------------------------------------atgcagaacag
A0A3B4BVX1_BCL2L11      ggaggaccgtatacatcaccttcctcattatctgcggtcaaaccgggccg
A0A3B4BVX1_BCL2L11      --------------------------------ggcggtcaaaccgggccg
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       ttatcggacg----------------------------------------
A0A3B4DUY7_BAD-01       gaaactgaggagagctcgttttaattgcgaagaggagcgatataagaaag
                                                                          

A0A3B4BVX1_BCL2L11      taattactgctgtttt----gagcagggggagagtggtcagagcagcgga
A0A3B4BVX1_BCL2L11      gccgcccagccttcttaaaggagcagggggagagtggtcagagcagcgga
A0A3B4BVX1_BCL2L11      gccgcccagccttcttaaaggagcagggggagagtggtcagagcagcgga
A0A3B4CNJ8_BMF-01       ----------------tgaagatgaagatgatgtttttgtgatggataca
A0A3B4CPH6_BAD-01       --actcagacac-atctgaagatctaggagacgc-------------aga
A0A3B4DUY7_BAD-01       taattaaaacactgactggagagaaagga-acgccttt--------taac
                                            **    *   *                   

A0A3B4BVX1_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgag---cagcctgagcccgg
A0A3B4BVX1_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgag---cagcctgagcccgg
A0A3B4BVX1_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgag---cagcctgagcccgg
A0A3B4CNJ8_BMF-01       caatatt--------ggcgttcctcaatcaggg---------------ag
A0A3B4CPH6_BAD-01       cca------------gccagaagccagtaagag-----------------
A0A3B4DUY7_BAD-01       ccattgt--------gctggaattcattaagaaccacagcttgcgcaatg
                          *            *        ** *  *                   

A0A3B4BVX1_BCL2L11      cgagggggacccggttaggggagggattacaat-gcctaatagccttctg
A0A3B4BVX1_BCL2L11      cgagggggacccggttaggggagggattacaat-gcctaatagccttctg
A0A3B4BVX1_BCL2L11      cgagggggacccggttaggggagggattacaat-gcctaatagccttctg
A0A3B4CNJ8_BMF-01       ataaag---------caggaggagcgtggcact-------cagactccgg
A0A3B4CPH6_BAD-01       ------------------agctgagctgtcaca------------gtctg
A0A3B4DUY7_BAD-01       gaaaag---------cacagtgaagatggcataagtaccatggatgacca
                                                  *  **                *  

A0A3B4BVX1_BCL2L11      ggttaccagtcgcgttcgcctctcttccgaacactatccaggtcctcaag
A0A3B4BVX1_BCL2L11      ggttaccagtcgcgttcgcctctcttccgaacactatccaggtcctcaag
A0A3B4BVX1_BCL2L11      ggttaccagtcgcgttcgcctctcttccgaacactatccaggtcctcaag
A0A3B4CNJ8_BMF-01       ggcg-------gccgccagctcggcccaacg--------gcatgctgccc
A0A3B4CPH6_BAD-01       ggca-------gcaccca-cttgttccagag--------agattca----
A0A3B4DUY7_BAD-01       agat-------gaatcca-attggt-cagag--------acggtcaagaa
                         *         *    *   *     *                 *     

A0A3B4BVX1_BCL2L11      cggatacttttcg---tttgagagcgagcccagctctccgctcctgacct
A0A3B4BVX1_BCL2L11      cggatacttttcg---tttgagagcgagcccagctctccgctcgtgacgc
A0A3B4BVX1_BCL2L11      cggatacttttcg---tttgagagcgagcccagctctccgctcgtgacgc
A0A3B4CNJ8_BMF-01       tgtggagtgt------ctgaggagccaagacgcctattctacggtagcgc
A0A3B4CPH6_BAD-01       -------------------gagagtcaa---g----------------gc
A0A3B4DUY7_BAD-01       tggtgactctccacagctggacagtcagcaca----------------gc
                                              **  *                       

A0A3B4BVX1_BCL2L11      ------------------ctccttctctgtctg-----------------
A0A3B4BVX1_BCL2L11      acagcgcgtccacgcagacccccagcccgtctagtcaagtaatca-----
A0A3B4BVX1_BCL2L11      acagcgcgtccacgcagacccccagcccgtctagtcaagtaatca-----
A0A3B4CNJ8_BMF-01       --aggattgctactactagcaccatctgtccgtcctgaacacgttgagg-
A0A3B4CPH6_BAD-01       --agaggaatcact-ctat-----------------gaat-----gagg-
A0A3B4DUY7_BAD-01       --atggcaagcaac-atatcaccagcttccccagacgaactgtcagaggt
                                                                          

A0A3B4BVX1_BCL2L11      -------tgtgttccaca--------------------------------
A0A3B4BVX1_BCL2L11      -----ctcacgccctgcagcgcattgctg---------------------
A0A3B4BVX1_BCL2L11      -----ctcacgccctgcagcgcattgctg---------------------
A0A3B4CNJ8_BMF-01       ---gtgccatg--cttcagga-----------------------------
A0A3B4CPH6_BAD-01       --------atgcccttcaggaatctg------------------------
A0A3B4DUY7_BAD-01       tgggtgtcgtgttcggctgtactctgagtcccaggtgtacacggtcagcc
                                  *  *  *                                 

A0A3B4BVX1_BCL2L11      ----------------------------------------------gaat
A0A3B4BVX1_BCL2L11      --------------------aggcgcgagggaacgctcagactttcgaat
A0A3B4BVX1_BCL2L11      --------------------aggcgcgagggaacgctcagactttcgaat
A0A3B4CNJ8_BMF-01       --------------------ggacc------------------agctcgc
A0A3B4CPH6_BAD-01       --------------------gggctgtgagacatgga-gatggagctgca
A0A3B4DUY7_BAD-01       gctggcaggacaatgaggatgggcttttagcggaggacggtggagcaggg
                                                                          

A0A3B4BVX1_BCL2L11      tatggcccctcta-------taaccaccatccgccccacggagcagcgcc
A0A3B4BVX1_BCL2L11      tatggcccctcta-------taaccaccatccgccccacggagcagcgcc
A0A3B4BVX1_BCL2L11      tatggcccctcta-------taaccaccatccgccccacggagcagcgcc
A0A3B4CNJ8_BMF-01       catggaacctcgg---------------agacggcccccac-aca----g
A0A3B4CPH6_BAD-01       gatggagactctttccgccgtcgctgtcgctcggctccccctgct----c
A0A3B4DUY7_BAD-01       gatggagctccattccgaggccgatcccagtcggctcctgctgca----c
                         ****     *                    ** * *      *      

A0A3B4BVX1_BCL2L11      tgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgca
A0A3B4BVX1_BCL2L11      tgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgca
A0A3B4BVX1_BCL2L11      tgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgca
A0A3B4CNJ8_BMF-01       tgtggaggccc---------------gtatcggtcagaagctccagatga
A0A3B4CPH6_BAD-01       tgtgggcagcaaagaa----------atat-ggcagacagctgaggaaga
A0A3B4DUY7_BAD-01       tgtggaaagccaagaa----------atat-gggcggcagctgaggagga
                        ** **    *                   * *      ****   *   *

A0A3B4BVX1_BCL2L11      tcggcgatgagtttaacgagctttattttc---------------acggg
A0A3B4BVX1_BCL2L11      tcggcgatgagtttaacgagctttattttc---------------acggg
A0A3B4BVX1_BCL2L11      tcggcgatgagtttaacgagctttattttc---------------acggg
A0A3B4CNJ8_BMF-01       tcggagatcagttctatcaagagcacatgctgcaacacagaa---accaa
A0A3B4CPH6_BAD-01       tgagtgacgagttcga-------caccttgctggacaaaggg---atgaa
A0A3B4DUY7_BAD-01       tgagtgatgaatttga-------cacctggctggataaaggggacacaag
                        *  * **  * **  *        *  *                 *    

A0A3B4BVX1_BCL2L11      gtgagtcagctgcatgggtgcgttgc--tggtatgcaagcgttgagtg--
A0A3B4BVX1_BCL2L11      gtgagtcagctgcatgggtgcgttgc--tggtatgcaagcgttgagtaat
A0A3B4BVX1_BCL2L11      gc-aggcag--aaatggaggcagagt--ccagctgccggcggaggaggaa
A0A3B4CNJ8_BMF-01       aggaacca-----------gcagcccttttggttgcgtttggcatcagcg
A0A3B4CPH6_BAD-01       gagagtgaggagtgcaggtgcagccc-gtcagatgcacgcttcccccagc
A0A3B4DUY7_BAD-01       aagagcga-----------gcagccc--tgggaagcagacgaaccgagga
                           *   *           **             **              

A0A3B4BVX1_BCL2L11      ------------------ctcgagatctgcacgatcaaatgtttgcttta
A0A3B4BVX1_BCL2L11      cctgttgccttttcaatcctggggcttt---ttcgtggacac--------
A0A3B4BVX1_BCL2L11      cctgccttcatgctgtggctggggctcg---tgatcagacgcctattaga
A0A3B4CNJ8_BMF-01       ttgtacacgctcct----gtttg---agagagagccggtggctaatggga
A0A3B4CPH6_BAD-01       tggttcaccttctt----atggagccacaaagagtcagactctgaggcca
A0A3B4DUY7_BAD-01       tggttctcttttct----ctggggttccaaagaa---------gaagaag
                                           *                              

A0A3B4BVX1_BCL2L11      agc------------------------------------taa
A0A3B4BVX1_BCL2L11      ---------------------------------------tga
A0A3B4BVX1_BCL2L11      ggtc--------------------ctcctaagacgaagatga
A0A3B4CNJ8_BMF-01       ggag----------------------agtggaccagaggtga
A0A3B4CPH6_BAD-01       gcagcagtctaacagctccagacacccgtccggcaga-gtga
A0A3B4DUY7_BAD-01       gaag------------------------------aga-ataa
                                                               * *

© 1998-2019