Dataset for CDS BAD of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4CPH6_BAD-01      atggctcat--atgttcacattatcggacg--------------------
A0A3B4DUY7_BAD-01      atgagcaatcaatatctgcagaaactgaggagagctcgttttaattgcga
                       ***    **  ** *   **  * * ** *                    

A0A3B4CPH6_BAD-01      ----------------------actcagacac-atctgaagatctaggag
A0A3B4DUY7_BAD-01      agaggagcgatataagaaagtaattaaaacactgactggagagaaagga-
                                             * * * ****   *** ***   **** 

A0A3B4CPH6_BAD-01      acgc-----agacca----gccagaagccagtaagag-------------
A0A3B4DUY7_BAD-01      acgccttttaacccattgtgctggaattcattaagaaccacagcttgcgc
                       ****     *  ***    **  ***  ** *****              

A0A3B4CPH6_BAD-01      -------------agctgagctgtcaca------------gtctgggcag
A0A3B4DUY7_BAD-01      aatggaaaagcacagtgaagatggcataagtaccatggatgaccaagatg
                                    **   ** ** ** *            * *   *  *

A0A3B4CPH6_BAD-01      cacccacttgttccagagagattca-----------------------ga
A0A3B4DUY7_BAD-01      aatccaattggt-cagagacggtcaagaatggtgactctccacagctgga
                        * *** *** * ******   ***                       **

A0A3B4CPH6_BAD-01      gagtcaa---ggcagaggaatcactctat-----------------gaat
A0A3B4DUY7_BAD-01      cagtcagcacagcatggcaagcaacatatcaccagcttccccagacgaac
                        *****     ***  * ** **   ***                 *** 

A0A3B4CPH6_BAD-01      -----gagg---------atgcccttcaggaatctg--------------
A0A3B4DUY7_BAD-01      tgtcagaggttgggtgtcgtgttcggctgtactctgagtcccaggtgtac
                            ****          **  *  * * * ****              

A0A3B4CPH6_BAD-01      ------------------------------gggctgtgagacatgga-ga
A0A3B4DUY7_BAD-01      acggtcagccgctggcaggacaatgaggatgggcttttagcggaggacgg
                                                     ***** * **    *** * 

A0A3B4CPH6_BAD-01      tggagctgcagatggagactctttccgccgtcgctgtcgctcggctcccc
A0A3B4DUY7_BAD-01      tggagcaggggatggagctccattccgaggccgatcccagtcggctcctg
                       ****** *  *******   * *****  * ** *  *  ********  

A0A3B4CPH6_BAD-01      ctgctctgtgggcagcaaagaaatatggcagacagctgaggaagatgagt
A0A3B4DUY7_BAD-01      ctgcactgtggaaagccaagaaatatgggcggcagctgaggaggatgagt
                       **** ******  *** ***********  * ********** *******

A0A3B4CPH6_BAD-01      gacgagttcgacaccttgctggacaaaggg---atgaagagagtgaggag
A0A3B4DUY7_BAD-01      gatgaatttgacacctggctggataaaggggacacaagaagagcga----
                       ** ** ** ******* ****** ******   *  *  **** **    

A0A3B4CPH6_BAD-01      tgcaggtgcagcccgtcagatgcacgcttcccccagctggttcaccttct
A0A3B4DUY7_BAD-01      -------gcagccc-tgggaagcagacgaaccgaggatggttctcttttc
                              ******* *  ** ***  *   **   * ****** * **  

A0A3B4CPH6_BAD-01      tatggagccacaaagagtcagactctgaggccagcagcagtctaacagct
A0A3B4DUY7_BAD-01      tctggggttccaaagaa---------gaagaaggaag-------------
                       * *** *   ******          ** *   * **             

A0A3B4CPH6_BAD-01      ccagacacccgtccggcagagtga
A0A3B4DUY7_BAD-01      -----------------agaataa
                                        *** * *

© 1998-2019