Dataset for CDS classical BH3-containing proteins of organism Pundamilia nyererei

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4ETH0_BMF-01      atggacga-----tgagga----ggacgatgtgtttgagcca--------
A0A3B4GXJ6_BAD-01      atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagagga
                       ****  *      * *  *     ***  **  *  *** **        

A0A3B4ETH0_BMF-01      --------------aaagccaactgttggcgcaccacattcagggagata
A0A3B4GXJ6_BAD-01      ggtaggggaaggagaaaaccaacagtcagcaggacaagctcaagaaagca
                                     *** ***** **  **    **   *** * *   *

A0A3B4ETH0_BMF-01      aagtgtgaacatcgaggcacacagacacccggtcctgccctggtacc-aa
A0A3B4GXJ6_BAD-01      ag----------------ccccagacgctt--tcccttcctgtaatcaaa
                       *                  * ***** *    ***   ****  * * **

A0A3B4ETH0_BMF-01      acaacggcatgctgccctgtggagtcgcagag-gagcccaga---ccact
A0A3B4GXJ6_BAD-01      acgacagc-tgctg------gaaggctcagggtgaactcagagtcccaca
                       ** ** ** *****      * ** * *** * ** * ****   **** 

A0A3B4ETH0_BMF-01      cttctacggtaacgcaggttttcgattgcacttccc--------ggcacg
A0A3B4GXJ6_BAD-01      cttcctcaattgccagggatgaggagctcatggctagaggggaggatgag
                       ****  *  *  *   ** *   **   **   *          *    *

A0A3B4ETH0_BMF-01      cttcgagctcgtcggggatcacagagcgagtcgacaaggaagcacggagc
A0A3B4GXJ6_BAD-01      gtttgtactc--------ccacagagggagac-ccattcaggcgaaggtc
                        ** *  ***         ******* *** *  **   * **   *  *

A0A3B4ETH0_BMF-01      agcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagc
A0A3B4GXJ6_BAD-01      a--aagtcagctc----cccctgctctgtgggctgcc-------------
                       *  **  ****      * ***** * *   **  **             

A0A3B4ETH0_BMF-01      gtggaggcctgcattggacagaaactccagctcataggagaccagtttca
A0A3B4GXJ6_BAD-01      ---aagaagtacggcaggcag---cttcgacgaatgagtgacgagtttga
                           **   * *    * ***   ** *  *  **  * *** ***** *

A0A3B4ETH0_BMF-01      ctgggaacgcctgcaactgtatcaccgaaaccaaaggaaccaggggccga
A0A3B4GXJ6_BAD-01      cag-----------------cttactagataaaggggagatgaaggtcaa
                       * *                  * **   *   *  ***      ** * *

A0A3B4ETH0_BMF-01      tgtggtggcgcctggccgcggccattctcagccttctgtttgat----ag
A0A3B4GXJ6_BAD-01      -gaagctgcaccactctaaaacctggtggagctatctctttagtcaccaa
                        *  *  ** **   *     **      ***  *** ***  *    * 

A0A3B4ETH0_BMF-01      ggggttcatagccggaggaggggg--------tggaggacgg--------
A0A3B4GXJ6_BAD-01      gag-------actgaaggagagaacaaccatcttgaaaaccacaaccaac
                       * *        * * ***** *          * **  **          

A0A3B4ETH0_BMF-01      -----aggtga
A0A3B4GXJ6_BAD-01      gcactgagtaa
                              ** *

© 1998-2019