Dataset for CDS classical BH3-containing proteins of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6EM90_PMAIP1-      atg---------------------------------cccgtgaagaaggc
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6FM79_BIK-01       atg--------------------------------------------tct
A0A2K6GL98_HRK-01       atg-----------------------------------------------
A0A2K6FQZ3_BBC3-01      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
A0A2K6FQZ3_BBC3-04      atg-----------------------------aaatttggtgcggggtct
A0A2K6GWV0_BAD-01       atg------------------ttccagatcccagagtttgagccaagtga
A0A2K6FFR1_BMF-02       atg------------------gagcc-atcccactgtgtg-----gagga
A0A2K6FFR1_BMF-01       atg------------------gagcc-atcccactgtgtg-----gagga

A0A2K6EM90_PMAIP1-      gcgtaagaacgcgc------------------------------------
A0A2K6GE31_BCL2L11      gaccgagaaggtggacagttgcaatctgtggagagacctccccagctcag
A0A2K6GE31_BCL2L11      gaccgagaaggtggacagttgcaatctgtggagagacctccccagctcag
A0A2K6GE31_BCL2L11      gaccgagaaggtggacagttgcaatctgtggagagacctccccagctcag
A0A2K6GE31_BCL2L11      gaccgagaaggtggacagttgcaatctgtggagagacctccccagctcag
A0A2K6GE31_BCL2L11      gaccgagaaggtggacagttgcaatctgtggagagacctccccagctcag
A0A2K6GE31_BCL2L11      gaccgagaaggtggacagttgcaatctgtggagagacctccccagctcag
A0A2K6FM79_BIK-01       gaggtgagacccgtctccacggacctcctcatggagaccttcccgttc--
A0A2K6GL98_HRK-01       -----------------------------------------------t--
A0A2K6FQZ3_BBC3-01      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctc--
A0A2K6FQZ3_BBC3-04      g--------------------------------------------ccc--
A0A2K6GWV0_BAD-01       gcaggaaga-------ctccagctctgcaggtaggg-gcctgggccccag
A0A2K6FFR1_BMF-02       gctggaggatgatgtgttccagc-cagaggatggggagtcggggacccag
A0A2K6FFR1_BMF-01       gctggaggatgatgtgttccagc-cagaggatggggagtcggggacccag

A0A2K6EM90_PMAIP1-      ---------aaccgagccc-------------------------------
A0A2K6GE31_BCL2L11      gcctg--------gggcccctacctccctacagacagagccccaag----
A0A2K6GE31_BCL2L11      gcctg--------gggcccctacctccctacagacagagccccaaggtaa
A0A2K6GE31_BCL2L11      gcctg--------gggcccctacctccctacagacagagccccaaggtaa
A0A2K6GE31_BCL2L11      gcctg--------gggcccctacctccctacagacagagccccaaggtaa
A0A2K6GE31_BCL2L11      gcctg--------gggcccctacctccctacagacagagccccaaggtaa
A0A2K6GE31_BCL2L11      gcctg--------gggcccctacctccctacagacagagcccca------
A0A2K6FM79_BIK-01       ---------gagcatctcctggaccctctgat-------cctggaggttc
A0A2K6GL98_HRK-01       ---------gcccgtgccc--------------------cct--------
A0A2K6FQZ3_BBC3-01      ---------ggccgtgtcctgcggcctctgcgagcccggcct--------
A0A2K6FQZ3_BBC3-04      ---------gggcatgtc---------------------cct--------
A0A2K6GWV0_BAD-01       cccctcaggggaccggccctcaggccccggcaagcatc-cct--------
A0A2K6FFR1_BMF-02       ccc----gggagcgtgctct-------ctgctgacctg-ttt--------
A0A2K6FFR1_BMF-01       ccc----gggagcgtgctct-------ctgctgacctg-ttt--------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      tcccgaaggcagtc------------------------------------
A0A2K6GE31_BCL2L11      tcccgaaggcagtc------------------------------------
A0A2K6GE31_BCL2L11      tcccgaaggcagtc------------------------------------
A0A2K6GE31_BCL2L11      tcccgaaggcagtc------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       tcagcatcatggac------------------------------------
A0A2K6GL98_HRK-01       ---gcaccgcggcc------------------------------------
A0A2K6FQZ3_BBC3-01      ---gcccgctgcccccgccgcccccgccctgctacccgctgcctacctct
A0A2K6FQZ3_BBC3-04      ---gccaggtgccc------------------------------------
A0A2K6GWV0_BAD-01       ---gcacggctcca------------------------------------
A0A2K6FFR1_BMF-02       ---gcccagagcca------------------------------------
A0A2K6FFR1_BMF-01       ---gcccagagcca------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ---------------------------gggaaggcgaaggggaccgctgc
A0A2K6GE31_BCL2L11      ---------------------------gggaaggcgaaggggaccgctgc
A0A2K6GE31_BCL2L11      ---------------------------gggaaggcgaaggggaccgctgc
A0A2K6GE31_BCL2L11      ---------------------------gggaaggcgaaggggaccgctgc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       ---------------------------------aacgaggagaatccc--
A0A2K6GL98_HRK-01       ---------------------------------------gcggccccc--
A0A2K6FQZ3_BBC3-01      gcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgc
A0A2K6FQZ3_BBC3-04      ---------------------------------------gggacttcc--
A0A2K6GWV0_BAD-01       -----------------------------agcttcctgggggacgcca--
A0A2K6FFR1_BMF-02       -----------------------------g-----ctggactgccccc--
A0A2K6FFR1_BMF-01       -----------------------------g-----ctggactgccccc--

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      tcccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A2K6GE31_BCL2L11      tcccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A2K6GE31_BCL2L11      tcccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A2K6GE31_BCL2L11      tcccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       ----------gacccctcggggtgcctcgaggacagtgacgaggtggccc
A0A2K6GL98_HRK-01       ---------------------cggccgtgtg-------------------
A0A2K6FQZ3_BBC3-01      tggcctgggggtccccgcagccgaccccgaggcccgcgcccggacggtcc
A0A2K6FQZ3_BBC3-04      -----------ttctcatggtgggtcctgggccatattcc----tggtcc
A0A2K6GWV0_BAD-01       -------gtcaccagcaggggcagcccag---------------------
A0A2K6FFR1_BMF-02       -------tcagccggc---ttcagctctt---------------------
A0A2K6FFR1_BMF-01       -------tcagccggc---ttcagctctt---------------------

A0A2K6EM90_PMAIP1-      ------------------------------gacgcggactcgggca----
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ttttgctaccagatcccc------------gcttttcatctttgtgagaa
A0A2K6GE31_BCL2L11      ttttgctaccagatcccc------------gcttttcatctttgtgagaa
A0A2K6GE31_BCL2L11      ttttgctaccagatcccc------------gcttttcatctttgtgagaa
A0A2K6GE31_BCL2L11      ttttgctaccagatcccc------------gcttttcatctttgtgagaa
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       tgcg-------gctagcctgcattggggatgagatggacctgtgtctcag
A0A2K6GL98_HRK-01       --------------cgcctgcagcgcgggtcgcctgggtctgcgct----
A0A2K6FQZ3_BBC3-01      tcagccatcactctcgctggcagagcag--cacctggagt--cgcc----
A0A2K6FQZ3_BBC3-04      tcagccatcactctcgctggcagagcag--cacctggagt--cgcc----
A0A2K6GWV0_BAD-01       ----------cagcagcagccaccatggaggagctgggtctgtgga----
A0A2K6FFR1_BMF-02       ----------ccctctcacccactgctgtggccctgggctt----c----
A0A2K6FFR1_BMF-01       ----------ccctctcacccactgctgtggccctgggctt----c----

A0A2K6EM90_PMAIP1-      ------------------gagatcgaagaggagtgtgcccttc-------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gatcctccctgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6GE31_BCL2L11      gatcctccctgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6GE31_BCL2L11      gatcctccctgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6GE31_BCL2L11      gatcctccctgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6GE31_BCL2L11      -------------------------------------------------a
A0A2K6FM79_BIK-01       gagcccccgcctggcctggctgcccgggatgaccatgcacagcctgg---
A0A2K6GL98_HRK-01       ---cgtccgccgcgc------------------agctcacagccgccc--
A0A2K6FQZ3_BBC3-01      ---cgtccccagcgccccgggggccctggcgggcggtcccacccaggc--
A0A2K6FQZ3_BBC3-04      ---cgtccccagcgccccgggggccctggcgggcggtcccacccaggc--
A0A2K6GWV0_BAD-01       -------------gacccggagtcgccacagctcgtaccccgcggggaca
A0A2K6FFR1_BMF-02       -------------gaccca-------------------ccagccagga-a
A0A2K6FFR1_BMF-01       -------------gaccca-------------------ccagccagga-a

A0A2K6EM90_PMAIP1-      -----aactcaggagacttggagacaaactgcatttcc------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gacaggagcccagcacccatgagttgtgacaaatcaac---------aca
A0A2K6GE31_BCL2L11      gacaggagcccagcacccatgagttgtgacaaatcaac---------aca
A0A2K6GE31_BCL2L11      gacaggagcccagcacccatgagttgtgacaaatcaac---------aca
A0A2K6GE31_BCL2L11      gacaggagcccagcacccatgagttgtgacaaatcaac---------aca
A0A2K6GE31_BCL2L11      gacaggagcccagcacccatgagttgtgacaaatcaac---------aca
A0A2K6FM79_BIK-01       -----ggctggcgctgtcctgtgaccagccggtccgct--ggggc----g
A0A2K6GL98_HRK-01       -----ggctcaaggcgctcggcgacgagctgcaccagc--gcacc----a
A0A2K6FQZ3_BBC3-01      -----ggccccgggagtccgg-ggggaggaggagcagt--gggcccgaga
A0A2K6FQZ3_BBC3-04      -----ggccccgggagtccgg-ggggaggaggagcagt--gggcccgaga
A0A2K6GWV0_BAD-01       gaagaggatgaagggatggaggaagagcccagccccttccggggccgctc
A0A2K6FFR1_BMF-02       gacaaggcc-----------------acccagaccctc------------
A0A2K6FFR1_BMF-01       gacaaggcc-----------------acccagaccctc------------

A0A2K6EM90_PMAIP1-      --agcagaaacttctgaatctgatagccaaact-----------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      aaccccaagtcctccttgccaggccttcaaccattatctcagtgca----
A0A2K6GE31_BCL2L11      aaccccaagtcctccttgccaggccttcaaccattatctcagtgca----
A0A2K6GE31_BCL2L11      aaccccaagtcctccttgccaggccttcaaccattatctcagtgca----
A0A2K6GE31_BCL2L11      aaccccaagtcctccttgccaggccttcaaccattatctcagtgca----
A0A2K6GE31_BCL2L11      aaccccaagtcctccttgccaggccttcaaccattatctcagtgca----
A0A2K6FM79_BIK-01       tgctcgggagccttagcg-acggtttc--gccaacctcaggg---a----
A0A2K6GL98_HRK-01       tgtggcggc---gccgcgcgcgga-gccggagggcgccagcgcccg----
A0A2K6FQZ3_BBC3-01      gatcggggcccagctgcg-gcggatggcagacgacctcaatgcgca----
A0A2K6FQZ3_BBC3-04      gatcggggcccagctgcg-gcggatggcagacgacctcaatgcgca----
A0A2K6GWV0_BAD-01       acgctcggcgccccccaacctctgggctgcacagcgctatggccgcgagc
A0A2K6FFR1_BMF-02       -agcccagcctccccaagccagggtgtcatgctgccttgtg---------
A0A2K6FFR1_BMF-01       -agcccagcctccccaagccagggtgtcatgctgccttgtg---------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      ------------------cttccatgaggcaatttcagg-----------
A0A2K6GE31_BCL2L11      --------------atggtt------------------------------
A0A2K6GE31_BCL2L11      --------------atggcttccatgaggcaatttcagg-----------
A0A2K6GE31_BCL2L11      --------------at----------------------------------
A0A2K6GE31_BCL2L11      --------------atggcttccatgaggcaatttcagg-----------
A0A2K6GE31_BCL2L11      --------------atggcttccatgaggcaatttcagg-----------
A0A2K6FM79_BIK-01       ------gtacgtg-gccaggctctggaggtcg------------------
A0A2K6GL98_HRK-01       ------gcgcgct-------------------------------------
A0A2K6FQZ3_BBC3-01      ------gtacgagcggcggagacaagaggagcagcagag-----------
A0A2K6FQZ3_BBC3-04      ------gtacgagcggcggagacaagaggagcagcagag-----------
A0A2K6GWV0_BAD-01       tccggaggatgagcgacgagttcgag-gactccttcaag-----------
A0A2K6FFR1_BMF-02       ------gggtgaccgaggaaccccagagactcttttatg-----------
A0A2K6FFR1_BMF-01       ------gggtgaccgaggaaccccagagactcttttatggcaatgctggc

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      ----------ctgaacctg-------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ----------ctgaacctg-------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ----------ctgaacctg-------------------------------
A0A2K6GE31_BCL2L11      ----------ctgaacctg-------------------------------
A0A2K6FM79_BIK-01       -ctcagccc-ccggccctgggtgtg-------------------------
A0A2K6GL98_HRK-01       -caccacctactggccctggctgtg-------------------------
A0A2K6FQZ3_BBC3-01      acaccgccc-ctcaccctggagggt-------------------------
A0A2K6FQZ3_BBC3-04      acaccgccc-ctcaccctggagggt-------------------------
A0A2K6GWV0_BAD-01       aagggacttcctcgcccgaagag---------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       taccggcttcctctccctgccagtttccctgcaggcttgccccttgggga

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       acagcccgctgaagggcagtggcaacatcgagcagaggtacagattgccc

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       gaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaa

A0A2K6EM90_PMAIP1-      ------------------------------------------tttccgct
A0A2K6GE31_BCL2L11      cagatatgcgcccggagatatggatcgcgcaggag-------ttgcggcg
A0A2K6GE31_BCL2L11      -------------agagaaataga--------------------------
A0A2K6GE31_BCL2L11      cagatatgcgcccggagatatggatcgcgcaggag-------ttgcggcg
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      cagatatgcgcccggagatatggatcgcgcaggag-------ttgcggcg
A0A2K6GE31_BCL2L11      cagatatgcgcccggagatatggatcgcgcaggag-------ttgcggcg
A0A2K6FM79_BIK-01       ccccgccccggcgtggg-agcaggtgctgctg----------ctgctg--
A0A2K6GL98_HRK-01       cgcggcc---------g-cgcaggtggcggcg----------ctggcggc
A0A2K6FQZ3_BBC3-01      cctgtac---------a-atctcatcatggga----------ctcctgcc
A0A2K6FQZ3_BBC3-04      cctgtac---------a-atctcatcatggga----------ctcctgcc
A0A2K6GWV0_BAD-01       cgcgggcacagcga----cgcagat-acggcagagctccagctggacgcg
A0A2K6FFR1_BMF-02       caccagcagaaccaaaatcgcatgtggtggcagatcctcctcttcctaca
A0A2K6FFR1_BMF-01       caccagcagaaccaaaatcgcatgtggtggcagatcctcctcttcctaca

A0A2K6EM90_PMAIP1-      ca---------------------------------gga------------
A0A2K6GE31_BCL2L11      tattggagatgagtttaacgcttattacccaaggaggctg----------
A0A2K6GE31_BCL2L11      -----------------------------------ggaagt---------
A0A2K6GE31_BCL2L11      tattggagatgagtttaacgcttattacccaaggaggatgc---------
A0A2K6GE31_BCL2L11      -----------------------------------gggtat---------
A0A2K6GE31_BCL2L11      tattggagatgagtttaacgcttattacccaaggagggtat---------
A0A2K6GE31_BCL2L11      tattggagatgagtttaacgcttattacccaaggagggtat---------
A0A2K6FM79_BIK-01       ctggtgctgctgctgctgggcgggggcctgcacctgct------------
A0A2K6GL98_HRK-01       ct--------ggctgctcggc----------aggcgga------------
A0A2K6FQZ3_BBC3-01      cttacccaggggccacagagc-----ccctgagatgga------------
A0A2K6FQZ3_BBC3-04      cttacccaggggccacagagc-----ccctgagatgga------------
A0A2K6GWV0_BAD-01       cgtcattcagtcctggtgggatcggaacgtgggcaggggaggttccgccc
A0A2K6FFR1_BMF-02       caaccttgctttgaacggagaagagaacaggaacggggcagg--------
A0A2K6FFR1_BMF-01       caaccttgctttgaacggagaagagaacaggaacggggcagg--------

A0A2K6EM90_PMAIP1-      --acttga------------------------------------------
A0A2K6GE31_BCL2L11      ------gcaaaa--------------------------------------
A0A2K6GE31_BCL2L11      --tgtcgtgtag--------------------------------------
A0A2K6GE31_BCL2L11      --ctct--------------------------------------------
A0A2K6GE31_BCL2L11      --ttttgaataa--------------------------------------
A0A2K6GE31_BCL2L11      --ttttgaataattaccaagccgacgaagaccaccctcaaatgcttatct
A0A2K6GE31_BCL2L11      --ttttgaataattaccaagccgacgaagaccaccctcaaatgcttatct
A0A2K6FM79_BIK-01       --gctcaagtga--------------------------------------
A0A2K6GL98_HRK-01       --acttg--tag--------------------------------------
A0A2K6FQZ3_BBC3-01      --gcccaattag--------------------------------------
A0A2K6FQZ3_BBC3-04      --gcccaattag--------------------------------------
A0A2K6GWV0_BAD-01       cctcccag-tga--------------------------------------
A0A2K6FFR1_BMF-02       --tcccag------------------------------------------
A0A2K6FFR1_BMF-01       --tcccaggtga--------------------------------------

A0A2K6EM90_PMAIP1-      -----------------------------------------------
A0A2K6GE31_BCL2L11      ---------tgcctggtaccctccatctga-----------------
A0A2K6GE31_BCL2L11      -----------------------------------------------
A0A2K6GE31_BCL2L11      ---------------------tccatctg-------------attaa
A0A2K6GE31_BCL2L11      -----------------------------------------------
A0A2K6GE31_BCL2L11      tgcgactgttacgttacattgtccgcctggtgtggaggaggcattga
A0A2K6GE31_BCL2L11      tgcgactgttacgttacattgtccgcctggtgtggaggaggcattga
A0A2K6FM79_BIK-01       -----------------------------------------------
A0A2K6GL98_HRK-01       -----------------------------------------------
A0A2K6FQZ3_BBC3-01      -----------------------------------------------
A0A2K6FQZ3_BBC3-04      -----------------------------------------------
A0A2K6GWV0_BAD-01       -----------------------------------------------
A0A2K6FFR1_BMF-02       -----------------------------------------------
A0A2K6FFR1_BMF-01       -----------------------------------------------

© 1998-2019