Dataset for CDS BMF of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6FFR1_BMF-02      atggagccatcccactgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6FFR1_BMF-01      atggagccatcccactgtgtggaggagctggaggatgatgtgttccagcc

A0A2K6FFR1_BMF-02      agaggatggggagtcggggacccagcccgggagcgtgctctctgctgacc
A0A2K6FFR1_BMF-01      agaggatggggagtcggggacccagcccgggagcgtgctctctgctgacc

A0A2K6FFR1_BMF-02      tgtttgcccagagccagctggactgccccctcagccggcttcagctcttc
A0A2K6FFR1_BMF-01      tgtttgcccagagccagctggactgccccctcagccggcttcagctcttc

A0A2K6FFR1_BMF-02      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga
A0A2K6FFR1_BMF-01      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga

A0A2K6FFR1_BMF-02      caaggccacccagaccctcagcccagcctccccaagccagggtgtcatgc
A0A2K6FFR1_BMF-01      caaggccacccagaccctcagcccagcctccccaagccagggtgtcatgc

A0A2K6FFR1_BMF-02      tgccttgtggggtgaccgaggaaccccagagactcttttatg--------
A0A2K6FFR1_BMF-01      tgccttgtggggtgaccgaggaaccccagagactcttttatggcaatgct

A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      ggctaccggcttcctctccctgccagtttccctgcaggcttgccccttgg

A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      ggaacagcccgctgaagggcagtggcaacatcgagcagaggtacagattg

A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag

A0A2K6FFR1_BMF-02      ---caccagcagaaccaaaatcgcatgtggtggcagatcctcctcttcct
A0A2K6FFR1_BMF-01      caacaccagcagaaccaaaatcgcatgtggtggcagatcctcctcttcct

A0A2K6FFR1_BMF-02      acacaaccttgctttgaacggagaagagaacaggaacggggcaggtccca
A0A2K6FFR1_BMF-01      acacaaccttgctttgaacggagaagagaacaggaacggggcaggtccca

A0A2K6FFR1_BMF-02      g----
A0A2K6FFR1_BMF-01      ggtga

© 1998-2019