Dataset for CDS BCL2L11 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
                        **************************************************

A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
                        **************************************************

A0A2K6GE31_BCL2L11      cctccctacagacagagccccaag--------------------------
A0A2K6GE31_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE31_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE31_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE31_BCL2L11      cctccctacagacagagcccca----------------------------
A0A2K6GE31_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
                        **********************                            

A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE31_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE31_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
                                                                          

A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE31_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE31_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
                                                                          

A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE31_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE31_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE31_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE31_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE31_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE31_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A2K6GE31_BCL2L11      --------------------------------------------cttcca
A0A2K6GE31_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A2K6GE31_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggtt----
A0A2K6GE31_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaat--------
A0A2K6GE31_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A2K6GE31_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
                                                                          

A0A2K6GE31_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A2K6GE31_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A2K6GE31_BCL2L11      -------------------------------------agagaaataga--
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A2K6GE31_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
                                                                          

A0A2K6GE31_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A2K6GE31_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A2K6GE31_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
                                                                          

A0A2K6GE31_BCL2L11      gaggctggcaaaatgcctggtaccctccatctga----------------
A0A2K6GE31_BCL2L11      gaggatg---------cctcttccatctgattaa----------------
A0A2K6GE31_BCL2L11      --ggaag---------tt-------gtcgtgtag----------------
A0A2K6GE31_BCL2L11      --gggta---------tt-------tttgaataa----------------
A0A2K6GE31_BCL2L11      gagggta---------tt-------tttgaataattaccaagccgacgaa
A0A2K6GE31_BCL2L11      gagggta---------tt-------tttgaataattaccaagccgacgaa
                          **                           *                  

A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gaccaccctcaaatgcttatcttgcgactgttacgttacattgtccgcct
A0A2K6GE31_BCL2L11      gaccaccctcaaatgcttatcttgcgactgttacgttacattgtccgcct
                                                                          

A0A2K6GE31_BCL2L11      -------------------
A0A2K6GE31_BCL2L11      -------------------
A0A2K6GE31_BCL2L11      -------------------
A0A2K6GE31_BCL2L11      -------------------
A0A2K6GE31_BCL2L11      ggtgtggaggaggcattga
A0A2K6GE31_BCL2L11      ggtgtggaggaggcattga
                                           

© 1998-2018