Dataset for CDS classical BH3-containing proteins of organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2NWG2_PMAIP1-01       atgcc-----------------------------------tggaaagaag
H2P5E2_BCL2L11-01      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
H2P4N6_BIK-01          atgtc---------------------------------tgaagtaaga--
A0A2J8T301_BMF-01      atgga----------gccatctcagtgtgtggaggagctggaggatgatg
A0A2J8TYJ3_BAD-01      atgtt----------ccagatcccagagtttgagccgagtgagcaggaag
H2NIS8_HRK-01          atg-----------------------------------------------
H2NZD3_BBC3-01         atggc----------cc--------------gcgcacggcaggagggcag
                       ***                                               

H2NWG2_PMAIP1-01       gc-----------gcgcaagaacgct----------caaccgagccccgc
H2P5E2_BCL2L11-01      acaattgcagcctgcggagagg-cctccccagctcagacctggggcccct
H2P4N6_BIK-01          ------cctatctccagagacatcc-----------tgatggagaccctc
A0A2J8T301_BMF-01      tg--ttccaaccagaggatgggg-------------agccggggaccc--
A0A2J8TYJ3_BAD-01      ac--tccagctctgcagagagg--------------ggcctgggcccc--
H2NIS8_HRK-01          ------------------------------------tgcccgtgtcccct
H2NZD3_BBC3-01         ct--ccccggagcccgtagagggcctggcccgcgacggcccgcgcccctt
                                                                * * ***  

H2NWG2_PMAIP1-01       gcg---------------------------------------ggctccgg
H2P5E2_BCL2L11-01      acctccctacagac----agagccacaagacaggagccc---ggcaccca
H2P4N6_BIK-01          ctgtatgagcagctcctggaacccccgaccatggaggttcttggc-----
A0A2J8T301_BMF-01      --aatccggaagct--tgctctctgctgacctgtttgcccagagc--cta
A0A2J8TYJ3_BAD-01      ------------------agccccgcaggggacaggccctcaggctccag
H2NIS8_HRK-01          gcaccgcgaccgc-----ggccccccggccgtgtgcgcctgcagc----g
H2NZD3_BBC3-01         cccgctcggccgcc--tggtgccctcggcagtgt---cctgcggcctctg
                                                                  **     

H2NWG2_PMAIP1-01       cagagc--------tggaagtcgag-------------------------
H2P5E2_BCL2L11-01      tgagttgtgacaaatcaacacaaaccccaagtcctcctt-----------
H2P4N6_BIK-01          -gtgactgact---ctgaagaggacctgg---------------------
A0A2J8T301_BMF-01      ctggactgccc---cctcagccgacttcagctcttccctctcac------
A0A2J8TYJ3_BAD-01      caa-----gca---tcatcgccaggccccaggcctcctgcgggacgccag
H2NIS8_HRK-01          cgggtc--gcc---tgg-ggctgcgctcg-----tccgccgcgcagc---
H2NZD3_BBC3-01         cgagcccggcc---tggccgccgcccccgccgcccccgccctgctgcccg
                                                                         

H2NWG2_PMAIP1-01       ------------------------------------------------tg
H2P5E2_BCL2L11-01      --------------------gccaggccttcaaccactatctcagtgc--
H2P4N6_BIK-01          ---------------------------------accctatggaggacttc
A0A2J8T301_BMF-01      ---------------------------------ccactgctgtggccctg
A0A2J8TYJ3_BAD-01      tcaccagcaggagcagccaaccag---cagcagccatcatggaggcgctg
H2NIS8_HRK-01          ------------------------------------tcaccgccgccc--
H2NZD3_BBC3-01         ctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctg
                                                                         

H2NWG2_PMAIP1-01       tgctactcaactcaggagatttggagacaaa------ctgaacttccggc
H2P5E2_BCL2L11-01      aatggcttc---catgaggcaggctgaacctgcagatatgcgcccggaga
H2P4N6_BIK-01          agtcctttggagtgcatggagggcagtgac----gcgttggccttgcggc
A0A2J8T301_BMF-01      g--ccttcgacccaccagccaggaagacaaagctacccagaccct-cagc
A0A2J8TYJ3_BAD-01      g--ggctgtgg-----agatccggagtcgccacagctcctaccccgcggg
H2NIS8_HRK-01          ---ggctcaaggcgctaggcgacgagctgcaccag--cgcaccatgtggc
H2NZD3_BBC3-01         gggggcccc---cgctggcctgggggtccccgcag--ccggccccgaggc
                                        *       *                *     * 

H2NWG2_PMAIP1-01       ----------------------------------------------agaa
H2P5E2_BCL2L11-01      tatggatcgcccaa-----------------------gagttgcggcgta
H2P4N6_BIK-01          tggcctgcatcggg-------------------gacgagatggacgtgag
A0A2J8T301_BMF-01      ccagcctcccccagccaaggtgtcatgctgccttgtggggtgactgagga
A0A2J8TYJ3_BAD-01      gacggaggacgacg--aagg------------------gatgggggagga
H2NIS8_HRK-01          ggcgccgcgcgcgg--a---------------------------------
H2NZD3_BBC3-01         ----ccgcgcccgg--acggtcctcagccctcgctctcgctggcggagca
                                                                         

H2NWG2_PMAIP1-01       actt------------------------ctgaatctgatatcc-------
H2P5E2_BCL2L11-01      -----------------tcggagacga-----gtttaacgctt-------
H2P4N6_BIK-01          cctc-------------agggccccgcgccgggcccagctccc-------
A0A2J8T301_BMF-01      accccagcgactcttttatggcaatgc-tggctaccggcttcctctccct
A0A2J8TYJ3_BAD-01      gccc-----agcccctttcggggccgt-tcgcgctcggcgccc-------
H2NIS8_HRK-01          --gc-------------cggagggcgc-cggcgcccagc-----------
H2NZD3_BBC3-01         gcac-------------ctggagtcgc-ccgtgcccagcgccc-------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
H2P5E2_BCL2L11-01      --------------------------------actatgcaaggagggtat
H2P4N6_BIK-01          ------------------------------------------cgaggtgg
A0A2J8T301_BMF-01      gccagtttcccggcagtcttgcctactggggagcagcccc--ctgaaggg
A0A2J8TYJ3_BAD-01      -----------------cccaatctctgggcagca----cagcgctatgg
H2NIS8_HRK-01          --------------------------------gcgctcccaacctactgg
H2NZD3_BBC3-01         -----------------cgggggctctggcgggcggtcccacccaggcgg
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
H2P5E2_BCL2L11-01      ttttgaat--------------------aattaccaagcagccgaagacc
H2P4N6_BIK-01          ccatgcac-------------------------------agcctgggtct
A0A2J8T301_BMF-01      cagtggca--acatcgagcagaggtacagattgcccgaaagcttcag--t
A0A2J8TYJ3_BAD-01      ccgcgagc-tccggaggatgagtgacgagtttgt-----------ggact
H2NIS8_HRK-01          ccctggctgtgcgcgg----------------------------------
H2NZD3_BBC3-01         ccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcc
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
H2P5E2_BCL2L11-01      acccacgaatggttatcttacgactgttacg-------------------
H2P4N6_BIK-01          ggctttca--------tctacgaccagactgagga-------catcaggg
A0A2J8T301_BMF-01      gcattgcagaccagttccaccggcttc-atgtgcagcaacaccagcagaa
A0A2J8TYJ3_BAD-01      cctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcag
H2NIS8_HRK-01          ----------------------------ccgcgcag-----gtggcg---
H2NZD3_BBC3-01         cagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggag
                                                                         

H2NWG2_PMAIP1-01       ----------------------aaactcttctgctcaggaacc-------
H2P5E2_BCL2L11-01      -------------------------ttacattgtccgc------------
H2P4N6_BIK-01          atgttcttagaagtttcacggacggtttcaccac----------------
A0A2J8T301_BMF-01      ccgaaatcgcgtgtggtggcagatcctcctcttcctgc-------acaac
A0A2J8TYJ3_BAD-01      at-------------gcggcaaagctccagctggacgcgagtcttccaat
H2NIS8_HRK-01          ---------------gcgctggcggcctggctgctcgg------------
H2NZD3_BBC3-01         acaaga------ggagcagcagcggcaccgcccctcgc------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
H2P5E2_BCL2L11-01      ----------------------------------------ctggtatgga
H2P4N6_BIK-01          ---------------------------------------ccttaaggaaa
A0A2J8T301_BMF-01      cttg-----------------------------------ctttgaatgga
A0A2J8TYJ3_BAD-01      cctggtgggatcggaa------------------------cttgggcagg
H2NIS8_HRK-01          c-------------------------------------------------
H2NZD3_BBC3-01         cctggagggtcctgtacaatctcatcatgggactcctgcccttacccagg
                                                                         

H2NWG2_PMAIP1-01       ------------------------------tga
H2P5E2_BCL2L11-01      gaatgc----------------------attga
H2P4N6_BIK-01          acataatgaggttctggagc----tccctgtaa
A0A2J8T301_BMF-01      gaagagaacaggaacggggcaggccctaggtga
A0A2J8TYJ3_BAD-01      ggaagctccgccccc---------tcccagtga
H2NIS8_HRK-01          ----------------aggcggaacttg--tag
H2NZD3_BBC3-01         ggccacagagcccccgagatggagcccaattag
                                                     *  

© 1998-2018