Dataset for CDS BCL2L11 of organism Poecilia mexicana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3YII5_BCL2L11      atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaac
A0A3B3YII5_BCL2L11      atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaac
                        **************************************************

A0A3B3YII5_BCL2L11      gccagcagaggggaccggcggagacccagcatcgtcagcgcgaacaccac
A0A3B3YII5_BCL2L11      gccagcagaggggaccggcggagacccagcatcgtcagcgcgaacaccac
                        **************************************************

A0A3B3YII5_BCL2L11      gttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctcc
A0A3B3YII5_BCL2L11      gttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctcc
                        **************************************************

A0A3B3YII5_BCL2L11      acagccgggggaggaggaggagggggaggaggaggaagaggggagccgga
A0A3B3YII5_BCL2L11      acagccgggggaggaggaggagggggaggaggaggaagaggggagccgga
                        **************************************************

A0A3B3YII5_BCL2L11      ttcggactcgccgccgtgctccgtgagcccggccagtttagacgtctttc
A0A3B3YII5_BCL2L11      ttcggactcgccgccgtgctccgtgagcccggccagtttagacgtctttc
                        **************************************************

A0A3B3YII5_BCL2L11      gaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttc
A0A3B3YII5_BCL2L11      gaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttc
                        **************************************************

A0A3B3YII5_BCL2L11      tcctttgactgcgactcgctgccgagctccccgctctctccgcacccagt
A0A3B3YII5_BCL2L11      tcctttgactgcgactcgctgccgagctccccgctctctccgcacccagt
                        **************************************************

A0A3B3YII5_BCL2L11      gacggctgacaaagccacgcagacccccagccccaccggccaggtgatga
A0A3B3YII5_BCL2L11      gacggctgacaaagccacgcagacccccagccccaccggccaggtgatga
                        **************************************************

A0A3B3YII5_BCL2L11      accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcac
A0A3B3YII5_BCL2L11      accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcac
                        **************************************************

A0A3B3YII5_BCL2L11      gggcactctcccaaccactatagcactattaacgcggcgcgggatatgca
A0A3B3YII5_BCL2L11      gggcactctcccaaccactatagcactattaacgcggcgcgggatatgca
                        **************************************************

A0A3B3YII5_BCL2L11      gtcagaaaactttggtcgtcaactccgtgctattggagatgactacaaca
A0A3B3YII5_BCL2L11      gtcagaaaactttggtcgtcaactccgtgctattggagatgactacaaca
                        **************************************************

A0A3B3YII5_BCL2L11      accacctgatgaggatggcgagaagacaccaacggaatatagtccctcta
A0A3B3YII5_BCL2L11      accacctgatgaggatggcgagaagacaccaacggaatatagtccctcta
                        **************************************************

A0A3B3YII5_BCL2L11      aacctgatgccacacatccagcaagagcctgttgccatgctttgtgtctg
A0A3B3YII5_BCL2L11      aacctgatgccacacatccagcaagagcctgttgccatgctttgtgtctg
                        **************************************************

A0A3B3YII5_BCL2L11      ccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaa
A0A3B3YII5_BCL2L11      ccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaa
                        **************************************************

A0A3B3YII5_BCL2L11      gcagccacgaccactctcaggtttag
A0A3B3YII5_BCL2L11      gcagccacgaccactctcaggtttag
                        **************************

© 1998-2019