Dataset for CDS classical BH3-containing proteins of organism Poecilia formosa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A087X8P8_BAD-01      atgga-----cgcaaaatttacaatttcagacagcgactcggagccatcg
A0A096LRV0_BMF-01      atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcg
                       *****      * *  **      *** ** ***   *     **   **

A0A087X8P8_BAD-01      gaagacgtagaggaaagaggaaacttgcag-ctaatgcaagtaaaggaga
A0A096LRV0_BMF-01      cacgcccttcagg-gagataaagtgtgaagaccggggcacgcaga-----
                        * * * *  ***  ***  **   ** ** *    *** * * *     

A0A087X8P8_BAD-01      ggccgctcagtcaacgccacaccct---------cacgcttcct------
A0A096LRV0_BMF-01      ---cgcccggtccgggccaggcgctacacaacggcatgctgccctgtggt
                          *** * ***   ****  * **         ** *** **       

A0A087X8P8_BAD-01      ---------gagctccga-------tctacaacaggtcggg--tgagact
A0A096LRV0_BMF-01      gttgcggaggagcccagacgactattctacggtaacgcaggttttcgatt
                                **** * **       *****   *   * **  *  ** *

A0A087X8P8_BAD-01      gaactcggagtccatcgc--ttccaccatctccaga-----gaggaggag
A0A096LRV0_BMF-01      gcactt----cccagcgcattttgaacttgtcggggattttgacgcgagg
                       * ***      *** ***  **  * * * **  *      ** * *  *

A0A087X8P8_BAD-01      ctgcaggccaggggggaagaggaagtcgggacccccactgagggctttcc
A0A096LRV0_BMF-01      caaca----agaggagcagaacaggatggagc----------agttaccc
                       *  **    ** ** * ***  * *  **  *           * *  **

A0A087X8P8_BAD-01      attcaggggccgatctaattcagctcccccctccctgtgggccgccaaga
A0A096LRV0_BMF-01      ctgcaccagccggctgcactcagct----------tggaggcctgca---
                        * **   ****     * ******          **  ****  **   

A0A087X8P8_BAD-01      agtatggccggcagcttcggaggatgagcgatgagtttgtcaacctgctt
A0A096LRV0_BMF-01      ---tcgggcagaagcttcagctgataggcgaccagttt------------
                            ** * * ****** *  ***  ****  *****            

A0A087X8P8_BAD-01      gataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagaccgat
A0A096LRV0_BMF-01      --caccgggaacacttacaa------cagtaccaacaaaaccaaaggaat
                          *  *** * *     **      *******      * ** *   **

A0A087X8P8_BAD-01      acaccactccaggagc-----tggtggagc-------tacctct--tcag
A0A096LRV0_BMF-01      ---------caggggccgctgtggtggcgcatgactgcagctcttctcag
                                **** **     ****** **        * ****  ****

A0A087X8P8_BAD-01      tcacc--------aggagacgga-----gggagagaacaaccaccacgaa
A0A096LRV0_BMF-01      cctcctgtttcatagggggtttattgctggaggaggtggagcaggacgga
                        * **        *** *    *     **  ***    * **  *** *

A0A087X8P8_BAD-01      aaccacgcctcccgcaccgagtag
A0A096LRV0_BMF-01      -------------------ggtga
                                           **  

© 1998-2018