Dataset for CDS classical BH3-containing proteins of organism Pelodiscus sinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


K7FRX2_BMF-01          atggatc--------------cccccagctacctg------gaagaagac
K7GA86_BCL2L11-01      atggggcgggcagggcgcgggccgggagctgcacaatcagtgcaggcgcc
                       ****  *              **   **** *         * **  * *

K7FRX2_BMF-01          ------tattctagcct-----------------------ggacg---gg
K7GA86_BCL2L11-01      gcgccgcgtcccagccttttgtcccgtggcgggggggtccgagcgcgcgg
                               * * *****                       *  **   **

K7FRX2_BMF-01          ctggacgatgacgtgtttcactctga--tgactttggactcacaggtcag
K7GA86_BCL2L11-01      ctgcccgattcccagctccggccggggcggactcggagcgccggggtctg
                       ***  ****  *  * * *   * *    ****  *  * *   **** *

K7FRX2_BMF-01          cctggtgagatgactcct--------actggcatt--ttcacacagaacc
K7GA86_BCL2L11-01      gctgagga-attgctcttggagcctgactcgcttttgttcagacaaagcc
                        ***  ** **  *** *        *** ** **  **** *** * **

K7FRX2_BMF-01          aatcgtacagctgcctcctgg-----ggaggtttcaactgttcccactca
K7GA86_BCL2L11-01      tttctgcgagttactctttggacgcaggaaaaggcga-----ccaaatgg
                         **    ** * *    ***     ***     * *     ** * *  

K7FRX2_BMF-01          ca---cactgctgtggtccaggtatcaggcatg-ctgagcagcaggaca-
K7GA86_BCL2L11-01      caaagcaaccttctgatctgaattcagagtgcgacggagaaggtggacag
                       **   **    * ** **    *     *   * * *** **  ***** 

K7FRX2_BMF-01          ----aggcaacccaaacac----tcagcc-catcctcttccactcaggat
K7GA86_BCL2L11-01      tttcagtcaattgaaaggccaagtcagcctcagcatcttagacctggggc
                           ** ***   ***  *    ****** ** * ****  **   **  

K7FRX2_BMF-01          gtcatgttgccatgtggagtcactg-------aagagcccca--------
K7GA86_BCL2L11-01      -ccctacctctatacaaacacagtaccaagacaggagccctgtgcctatg
                         * *    * **    *  ** *        * ******          

K7FRX2_BMF-01          ----gagactcttctatgggaatgctgggtaccgtttacatgaaccccca
K7GA86_BCL2L11-01      agttgcgacaagtcgacgcagactccaagtcccccttgt-caagccttta
                           * ***   ** * *   *  *   ** **  **     * **   *

K7FRX2_BMF-01          gttggcttc-----gcattgaatccgca--------cctccaag-aggag
K7GA86_BCL2L11-01      atcattatctaagtgcaatgggtaagcaagatcatgcttccaggtgggag
                        *     **     *** **  *  ***        * **** *  ****

K7FRX2_BMF-01          cctcgggaaggtcaccaggaagcccgggctgaggttcagattgcacggaa
K7GA86_BCL2L11-01      tccccctcaatacgtgaagacatgcagccagaaatatggattgcacagga
                        * *    *   *   * **    * * * **  *   ******** * *

K7FRX2_BMF-01          gttacagtgcatagcagaccagtt-----ccacaggctccacatacagag
K7GA86_BCL2L11-01      gctgcggcgaattggagatgagtttaatgcctcttactgcccaagaaggg
                       * * * * * ** * ***  ****     ** *   ** * **   ** *

K7FRX2_BMF-01          gcatc-----------agcagaacagaaatcaagtgtggtggcagatcct
K7GA86_BCL2L11-01      gtttcttggataatcaagcaataaaccaccaaattgttttg-----cgct
                       *  **           ****  * *  *   ** ***  **       **

K7FRX2_BMF-01          tcttttcctacataacttggccttaaatgtggaggcgaacaggaaccaca
K7GA86_BCL2L11-01      tgttgcattacatca-tccgcctcatttggagaat---------------
                       * **    ***** * *  **** *  **  **                 

K7FRX2_BMF-01          taggtcagaggtga
K7GA86_BCL2L11-01      -------gcagtaa
                              *  ** *

© 1998-2018