Dataset for CDS classical BH3-containing proteins of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

22 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A096MPU8_PMAIP1-      atgcc---------------------------------------------
A0A096MPU8_PMAIP1-      atgcc---------------------------------------------
A0A096NKG5_BIK-01       atgtctggagttagacccatctccagagacatcttgatggagaccct---
A0A096N944_HRK-01       atgtg-----------------cccgtgccc-------------------
A0A2I3MCN5_BAD-03       atgtt-----------------ccagatccc---------agagttt---
A0A2I3MCN5_BAD-02       atgtt-----------------ccagatccc---------agagttt---
A0A2I3MCN5_BAD-04       atgtt-----------------ccagatccc---------agagttt---
A0A2I3MCN5_BAD-01       atgtt-----------------ccagatccc---------agagttt---
A0A2I3N2Z9_BBC3-03      ataaa-----------------a---------tttggcgtggggtctgcc
A0A096NTE9_BMF-01       atgg--------------------agccatc-------------tcg---
A0A096NTE9_BMF-02       atgg--------------------agccatc-------------tcg---
A0A096NTE9_BMF-03       atgg--------------------agccatc-------------tcg---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---
A0A2I3M6I1_BCL2L11      atggc-----------------aaagcaaccttctgatgtaagttct---

A0A096MPU8_PMAIP1-      ----------tgggaag--------------aagg---------------
A0A096MPU8_PMAIP1-      ----------tgggaag--------------aagg---------------
A0A096NKG5_BIK-01       ----cctgtatgagcagctcctggaacccctaaccatggaggttcttggt
A0A096N944_HRK-01       -------------------------------------------------c
A0A2I3MCN5_BAD-03       -gagcctag-tgagcag--------------gaagac------tccagat
A0A2I3MCN5_BAD-02       -gagcctag-tgagcag--------------gaagac------tccagct
A0A2I3MCN5_BAD-04       -gagcctag-tgagcag--------------gaagac------tccagat
A0A2I3MCN5_BAD-01       -gagcctag-tgagcag--------------gaagac------tccagct
A0A2I3N2Z9_BBC3-03      cgggcatgtccatgcca--------------ggtgcccagggcttct--t
A0A096NTE9_BMF-01       -gtgtgtggaggagctg--------------gaggatgatgtgttccagc
A0A096NTE9_BMF-02       -gtgtgtggaggagctg--------------gaggatgatgtgttccagc
A0A096NTE9_BMF-03       -gtgtgtggaggagctg--------------gaggatgatgtgttccagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc
A0A2I3M6I1_BCL2L11      -gagtgtgaccgagaag--------------gtagacaa----ttgcagc

A0A096MPU8_PMAIP1-      ----------cgcgcaagaacgcgcaaccgagcccaacgcgggctca---
A0A096MPU8_PMAIP1-      ----------cgcgcaagaacgcgcaaccgagcccaacgcgggctca---
A0A096NKG5_BIK-01       gtgactgaccctgaagaggacctggacccta---t--ggaggacttcgat
A0A096N944_HRK-01       ctg-------caccgcggccgcggccccccggccg--tgtgcgcc-----
A0A2I3MCN5_BAD-03       ctg-------cagagaggggcctgggccccagccc--cgcgggggacaag
A0A2I3MCN5_BAD-02       ctg-------cagagaggggcctgggccccagccc--cgcgggggacaag
A0A2I3MCN5_BAD-04       ctg-------cagagaggggcctgggccccagccc--cgcgggggacaag
A0A2I3MCN5_BAD-01       ctg-------cagagaggggcctgggccccagccc--cgcgggggacaag
A0A2I3N2Z9_BBC3-03      ctg-------cgacgtgggtcccctg--ccagatt--tgtggtcctcagc
A0A096NTE9_BMF-01       cgg-------aggacggggagccgggggcccaacc--cgggagctcg--c
A0A096NTE9_BMF-02       cgg-------aggacggggagccgggggcccaacc--cgggagctcg--c
A0A096NTE9_BMF-03       cgg-------aggacggggagccgggggcccaacc--cgggagctcg--c
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
A0A2I3M6I1_BCL2L11      ctg-------cggagaggcctccccagctcagacc--tggggcccctacc
                                         *                    * *         

A0A096MPU8_PMAIP1-      ---------ggcag------------------------------------
A0A096MPU8_PMAIP1-      ---------ggcaggacagg-----cagggacggcagggacggcgaggga
A0A096NKG5_BIK-01       cctt-----tggagtgtatggaggacagtgacatg---------------
A0A096N944_HRK-01       ---------tgcagcgcgggtcgtttggggctgcg---------------
A0A2I3MCN5_BAD-03       ccct---------------------cagactc------------------
A0A2I3MCN5_BAD-02       ccct---------------------cagactc------------------
A0A2I3MCN5_BAD-04       ccct---------------------cagactc------------------
A0A2I3MCN5_BAD-01       ccct---------------------cagactc------------------
A0A2I3N2Z9_BBC3-03      cctcgctcttgctgg----------cggagcagca---------------
A0A096NTE9_BMF-01       tctc-----tgccgatctgtttgcccagagcc------------------
A0A096NTE9_BMF-02       tctc-----tgccgatctgtttgcccagagcc------------------
A0A096NTE9_BMF-03       tctc-----tgccgatctgtttgcccagagcc------------------
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccaca---------------
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccaca---------------
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccacaaggtaatcccgaagg
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccacaaggtaatcccgaagg
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccaca---------------
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccaca---------------
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccacaaggtaatcccgaagg
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccacaaggtaatcccgaagg
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccacaaggtaatcccgaagg
A0A2I3M6I1_BCL2L11      tccc-----tacaga----------cagagccacaaggtaatcccgaagg

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      ccaggccggatttgggattgggatgcagctgcatttcaccagaagcaaaa
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------ctcgtccgccgc
A0A2I3MCN5_BAD-03       -------------------------------------------------c
A0A2I3MCN5_BAD-02       -------------------------------------------------c
A0A2I3MCN5_BAD-04       -------------------------------------------------c
A0A2I3MCN5_BAD-01       -------------------------------------------------c
A0A2I3N2Z9_BBC3-03      ----------cctggagtcgcccgtgcccagcgccccgggggccctggcg
A0A096NTE9_BMF-01       ----------------------------------------------tact
A0A096NTE9_BMF-02       ----------------------------------------------tact
A0A096NTE9_BMF-03       ----------------------------------------------tact
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      caatcacggaggtgaaggggacagctgcccccacggcagccctcagggcc
A0A2I3M6I1_BCL2L11      caatcacggaggtgaaggggacagctgcccccacggcagccctcagggcc
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      caatcacggaggtgaaggggacagctgcccccacggcagccctcagggcc
A0A2I3M6I1_BCL2L11      caatcacggaggtgaaggggacagctgcccccacggcagccctcagggcc
A0A2I3M6I1_BCL2L11      caatcacggaggtgaaggggacagctgcccccacggcagccctcagggcc
A0A2I3M6I1_BCL2L11      caatcacggaggtgaaggggacagctgcccccacggcagccctcagggcc

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      agctcgtctcctcctccccacttgcccttccgcggggccac---------
A0A096NKG5_BIK-01       ---ttggccctgcggctggcctg----catcggggacgaga---------
A0A096N944_HRK-01       gcagctcaccgccgcccggctcaaggcgcttggcgacgagc---------
A0A2I3MCN5_BAD-03       ggcaagcatcatcgccaggccccaggcctcctgtgggacgc---------
A0A2I3MCN5_BAD-02       ggcaagcatcatcgccaggccccaggcctcctgtgggacgc---------
A0A2I3MCN5_BAD-04       ggcaagcatcatcgccaggccccaggcctcctgtgggacgc---------
A0A2I3MCN5_BAD-01       ggcaagcatcatcgccaggccccaggcctcctgtgggacgc---------
A0A2I3N2Z9_BBC3-03      ggcggtcccacccaggcggccccgggagtccgcggggagga---------
A0A096NTE9_BMF-01       tgactgccccctcagccgacttcagctcttcc------------------
A0A096NTE9_BMF-02       tgactgccccctcagccgacttcagctcttcc------------------
A0A096NTE9_BMF-03       tgactgccccctcagccgacttcagctcttcc------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      cgctggccccaccggccagccctggcccttttgctaccagatccccgctt
A0A2I3M6I1_BCL2L11      cgctggccccaccggccagccctggcccttttgctaccagatccccgctt
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      cgctggccccaccggccagccctggcccttttgctaccagatccccgctt
A0A2I3M6I1_BCL2L11      cgctggccccaccggccagccctggcccttttgctaccagatccccgctt
A0A2I3M6I1_BCL2L11      cgctggccccaccggccagccctggcccttttgctaccagatccccgctt
A0A2I3M6I1_BCL2L11      cgctggccccaccggccagccctggcccttttgctaccagatccccgctt

A0A096MPU8_PMAIP1-      ----------------------------------agctcgaagtcg----
A0A096MPU8_PMAIP1-      -----------------gaggaacaagtgcaagtagctcgaagtcg----
A0A096NKG5_BIK-01       -----------------tggatgtgagcctcagggccc------------
A0A096N944_HRK-01       -------------------------tgcaccagcgcacc-----------
A0A2I3MCN5_BAD-03       -----------------cagtcaccagcaggagcagcc------------
A0A2I3MCN5_BAD-02       -----------------cagtcaccagcaggagcagcc------------
A0A2I3MCN5_BAD-04       -----------------cagtcaccagcaggagcagcc------------
A0A2I3MCN5_BAD-01       -----------------cagtcaccagcaggagcagcc------------
A0A2I3N2Z9_BBC3-03      --------------------------ggaacagtgggcccggg-------
A0A096NTE9_BMF-01       -----------------ctctcacccactgctgtggccct----------
A0A096NTE9_BMF-02       -----------------ctctcacccactgctgtggccct----------
A0A096NTE9_BMF-03       -----------------ctctcacccactgctgtggccct----------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggta
A0A2I3M6I1_BCL2L11      ttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggta
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggta
A0A2I3M6I1_BCL2L11      ttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggta
A0A2I3M6I1_BCL2L11      ttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggta
A0A2I3M6I1_BCL2L11      ttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggta

A0A096MPU8_PMAIP1-      ---------------agtgtgctactcaac--tcaggag-----------
A0A096MPU8_PMAIP1-      ---------------agtgtgctactcaac--tcaggag-----------
A0A096NKG5_BIK-01       ---------------cgcgcctggcccagctctctgagg-----------
A0A096N944_HRK-01       ---------------atgtggcggcgccgcg--cgcgga-----------
A0A2I3MCN5_BAD-03       ---------------aaccagcag--cagccatcatggagggacttcctc
A0A2I3MCN5_BAD-02       ---------------aaccagcag--cagccatcatggagggagagcttg
A0A2I3MCN5_BAD-04       ---------------aaccagcag--cagccatcatgg------------
A0A2I3MCN5_BAD-01       ---------------aaccagcag--cagccatcatgg------------
A0A2I3N2Z9_BBC3-03      ---------------agatcggggcccagctgcggcgga-----------
A0A096NTE9_BMF-01       ---------------ggccttcgacccaccagccaggaa-----------
A0A096NTE9_BMF-02       ---------------ggccttcgacccaccagccaggaa-----------
A0A096NTE9_BMF-03       ---------------ggccttcgacccaccagccaggaa-----------
A0A2I3M6I1_BCL2L11      ---------------agacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      ---------------agacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      ---------------agacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      ---------------agacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgag-----------
A0A2I3M6I1_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgag-----------
                                                  *  *                    

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       gcccg---------------------------------------------
A0A2I3MCN5_BAD-02       gtattctccttcttgggaatctgaggactctgaaaatcccagtgcaagga
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       tgctcgcggaagcatcagcaccgatgtctgccccagccactgactcagaa
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------

A0A096MPU8_PMAIP1-      ------------------------------atttggagacaaactgaact
A0A096MPU8_PMAIP1-      ------------------------------atttggagacaaactgaact
A0A096NKG5_BIK-01       ------------------------------------tggccatgcacagc
A0A096N944_HRK-01       ---------------------------------gccggagggcgccggcg
A0A2I3MCN5_BAD-03       ----------------------------aagagcgcgggc-acagcgacg
A0A2I3MCN5_BAD-02       gcccaacacgcagagaatgtaaagctgaaggcgctggggctgtggagacg
A0A2I3MCN5_BAD-04       ----------------------------aggcgctggggctgtggagacg
A0A2I3MCN5_BAD-01       ----------------------------aggcgctggggctgtggagacg
A0A2I3N2Z9_BBC3-03      ----------------------------tggcg----gacgacctcaacg
A0A096NTE9_BMF-01       --------------------------------gacaaggccacccagacc
A0A096NTE9_BMF-02       --------------------------------gacaaggccacccagacc
A0A096NTE9_BMF-03       --------------------------------gacaaggccacccagacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc
A0A2I3M6I1_BCL2L11      ----------------------------ttgtgacaaatcaacacaaacc

A0A096MPU8_PMAIP1-      tccggca-------------------------------gaaacttctgaa
A0A096MPU8_PMAIP1-      tccggca-------------------------------gaaacttctgaa
A0A096NKG5_BIK-01       ctgggtc-------------------------------tggctttcatct
A0A096N944_HRK-01       cccggcg----------------------------------cgctcccca
A0A2I3MCN5_BAD-03       cagatgc-----------------------------ggcaaagctccagc
A0A2I3MCN5_BAD-02       cggagtc-----------------------------gccacagctcctac
A0A2I3MCN5_BAD-04       cggagtc-----------------------------gccacagctcctac
A0A2I3MCN5_BAD-01       cggagtc-----------------------------gccacagctcctac
A0A2I3N2Z9_BBC3-03      cgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcg
A0A096NTE9_BMF-01       ctcggccca------------------------------gcctcccccag
A0A096NTE9_BMF-02       ctcggccca------------------------------gcctcccccag
A0A096NTE9_BMF-03       ctcggccca------------------------------gcctcccccag
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg
A0A2I3M6I1_BCL2L11      ccaagtc------------------------------------ctccttg

A0A096MPU8_PMAIP1-      tctgatag------------------------------------------
A0A096MPU8_PMAIP1-      tctgatag------------------------------------------
A0A096NKG5_BIK-01       acgaccagacggacgacatcagggatgttcttagaagtttcatggatggt
A0A096N944_HRK-01       cc------------------------------------------------
A0A2I3MCN5_BAD-03       tggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaag
A0A2I3MCN5_BAD-02       cccgcgggga-----------cggaggaggacgaagggatggaggaggag
A0A2I3MCN5_BAD-04       cccgcgggga-----------cggaggaggacgaagggatggaggaggag
A0A2I3MCN5_BAD-01       cccgcgggga-----------cggaggaggacgaagggatggaggaggag
A0A2I3N2Z9_BBC3-03      ccctggaggg--------tcctgtacaatctc--------atcatgggac
A0A096NTE9_BMF-01       cc----aagg--------tgtcatgctgccttgtggggtaactgaggaac
A0A096NTE9_BMF-02       cc----aagg--------tgtcatgctgccttgtggggtaactgaggaac
A0A096NTE9_BMF-03       cc----aagg--------tgtcatgctgccttgtggggtaactgaggaac
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------
A0A2I3M6I1_BCL2L11      cc----ag-------------------gcctt------------------

A0A096MPU8_PMAIP1-      -ccaaactcttc-------------------------tgctcaggaacct
A0A096MPU8_PMAIP1-      -ccaaactcttc-------------------------tgctcaggaacct
A0A096NKG5_BIK-01       ttcaccacccttagggagaacataatgaggttctggagatccccgaatcc
A0A096N944_HRK-01       tactggccctgg--------ctgtgcgcggccgcgcaggtggcg-gcgct
A0A2I3MCN5_BAD-03       ctccgccccctc--------c------cagtgaccttcgctccacgcccc
A0A2I3MCN5_BAD-02       cccagccccttt--------c-----ggggccgctcgcgctccgcgcccc
A0A2I3MCN5_BAD-04       cccagccccttt--------c-----ggggccgctcgcgctccgcgcccc
A0A2I3MCN5_BAD-01       cccagccccttt--------c-----ggggccgctcgcgctccgcgcccc
A0A2I3N2Z9_BBC3-03      tcctgcccttac--------ccaggggc----------------------
A0A096NTE9_BMF-01       cccagcgactct--------tttacggcaatgctggctaccggcttcctc
A0A096NTE9_BMF-02       cccagcgactct--------tttacggcaatgctggctaccggcttcctc
A0A096NTE9_BMF-03       cccagcgactct--------tttacg------------------------
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggtagtcattctagaggat
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatgga-----t-----gag--
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggt-----t----------
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaat-------------------
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggc-----ttccaggag--
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggc-----ttccaggag--
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggc-----ttccaggag--
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggc-----ttccaggag--
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggc-----ttccaggag--
A0A2I3M6I1_BCL2L11      --caaccactat--------ctcagtgcaatggc-----taactgg----

A0A096MPU8_PMAIP1-      ga------------------------------------------------
A0A096MPU8_PMAIP1-      gactgcatcaaaaacttgcatagggggactccaaaagagactttttct--
A0A096NKG5_BIK-01       caggtcctgggtgtcccgtgaacaggtgctgctggcgctgctgctgct--
A0A096N944_HRK-01       ggcggcctggctgctcggcaggcggaacttgtag----------------
A0A2I3MCN5_BAD-03       gaaactccacccgct------ctcactgtcctggtcggccatcttggata
A0A2I3MCN5_BAD-02       ------ccaacctctgggcagcacagcgttatggccgcgagctccgga--
A0A2I3MCN5_BAD-04       ------ccaacctctgggcagcacagcgttatggccgcgagctccgga--
A0A2I3MCN5_BAD-01       ------ccaacctctgggcagcacagcgttatggccgcgagctccgga--
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       tccctgccagtttcccggcagtcttgcccatcggggagcagccccccg--
A0A096NTE9_BMF-02       tccctgccagtttcccggcagtcttgcccatcggggagcagccccccg--
A0A096NTE9_BMF-03       --------------------------------------------------
A0A2I3M6I1_BCL2L11      ataggtgatagttcattgtggtttggatttatatttactggct-------
A0A2I3M6I1_BCL2L11      -----------------gccactggatcct---------ccct-------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      -----------------gcaggctgaacctgcagatatgcgcc-------
A0A2I3M6I1_BCL2L11      -----------------gcaggctgaacctgcagatatgcgcc-------
A0A2I3M6I1_BCL2L11      -----------------gcaggctgaacctgcagatatgcgcc-------
A0A2I3M6I1_BCL2L11      -----------------gcaggctgaacctgcagatatgcgcc-------
A0A2I3M6I1_BCL2L11      -----------------gcaggctgaacctgcagatatgcgcc-------
A0A2I3M6I1_BCL2L11      --------------------------------------------------

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------caggagatgcacacttca
A0A096NKG5_BIK-01       ---------------------------------------------gctgg
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       tgggcggaagtgcttccctcaggccttatgcaaaagaggatccgtgctcc
A0A2I3MCN5_BAD-02       --ggatga------------------------------------------
A0A2I3MCN5_BAD-04       --ggatgagtgacgagtttgtggactccttt---aagggacttcctcgcc
A0A2I3MCN5_BAD-01       --ggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcc
A0A2I3N2Z9_BBC3-03      ---------------------------------------cacagagcccc
A0A096NTE9_BMF-01       ------------aagggcagtggcaacatcgagcagaggtacagattgcc
A0A096NTE9_BMF-02       ------------aagggcagtggcaacatcgagcagaggtacagattgcc
A0A096NTE9_BMF-03       --------------------------------------------------
A0A2I3M6I1_BCL2L11      ---------------------------------tagatttgtatggccac
A0A2I3M6I1_BCL2L11      ---------------------------------cgga-------attgcc
A0A2I3M6I1_BCL2L11      ----------------------------------agagaaatag------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ---------------------------------cggagatacggatcgcc
A0A2I3M6I1_BCL2L11      ---------------------------------cggagatacggatcgcc
A0A2I3M6I1_BCL2L11      ---------------------------------cggagatacggatcgcc
A0A2I3M6I1_BCL2L11      ---------------------------------cggagatacggatcgcc
A0A2I3M6I1_BCL2L11      ---------------------------------cggagatacggatcgcc
A0A2I3M6I1_BCL2L11      --------------------------------------------------

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      tcaatttgaagaaagattgcattgtaattgg-------------------
A0A096NKG5_BIK-01       cactgctgctggcgctgctcagcgggggcctgca----------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       ctctttcggtgggagggctgacccagattc--------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2I3MCN5_BAD-04       cgaagagcgcgggcacagcgacgcagatgcggca----------------
A0A2I3MCN5_BAD-01       cgaagagcgcgggcacagcgacgcagatgcggca----------------
A0A2I3N2Z9_BBC3-03      cgaaa------------tggagcccaattag-------------------
A0A096NTE9_BMF-01       cgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagca
A0A096NTE9_BMF-02       cgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagca
A0A096NTE9_BMF-03       --------------------------------------------------
A0A2I3M6I1_BCL2L11      c--------------accacagtcaagatacaga----------------
A0A2I3M6I1_BCL2L11      c--------------ttcatagggaagttcagtg----------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      caagagttgcggcgaatcggagacgagtttaacg----------------
A0A2I3M6I1_BCL2L11      caagagttgcggcgaatcggagacgagtttaacg----------------
A0A2I3M6I1_BCL2L11      caagagttgcggcgaatcggagacgagtttaacg----------------
A0A2I3M6I1_BCL2L11      caagagttgcggcgaatcggagacgagtttaacg----------------
A0A2I3M6I1_BCL2L11      caagagttgcggcgaatcggagacgagtttaacg----------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       ------------------------------------cctgctgctcaagt
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       -----------------------------------ccttccggtgcatgt
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2I3MCN5_BAD-04       ---------------aagctccagctggacgcgagtcttccagtcctggt
A0A2I3MCN5_BAD-01       ---------------aagctccagctggacgcgagtcttccagtcctggt
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       acaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcctgc
A0A096NTE9_BMF-02       acaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcctgc
A0A096NTE9_BMF-03       -caccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcctgc
A0A2I3M6I1_BCL2L11      ------------------------------------acaactcaaccaca
A0A2I3M6I1_BCL2L11      ------------------------------------gccactg-------
A0A2I3M6I1_BCL2L11      -----------------------------------------------agg
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ------------------------------------cttactatgcaagg
A0A2I3M6I1_BCL2L11      ------------------------------------cttactatgcaagg
A0A2I3M6I1_BCL2L11      ------------------------------------cttactatgcaagg
A0A2I3M6I1_BCL2L11      ------------------------------------cttactatgcaagg
A0A2I3M6I1_BCL2L11      ------------------------------------cttactatgcaagg
A0A2I3M6I1_BCL2L11      --------------------------------------------------

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       ga------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       ga------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2I3MCN5_BAD-04       gggatcggaacttgggcaggggaagctccgccccctcccagtga------
A0A2I3MCN5_BAD-01       gggatcggaacttgggcaggggaagctccgccccctcccagtga------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       acaaccttgctttgaatggagaagagaacaggaacggggtggaccctagg
A0A096NTE9_BMF-02       acaaccttgctttgaatggagaagagaacaggaacggggtggaccctagg
A0A096NTE9_BMF-03       acaaccttgctttgaatggagaagagaacaggaacggggtggaccctag-
A0A2I3M6I1_BCL2L11      aggatttc----------tcatga--------------------------
A0A2I3M6I1_BCL2L11      ------------------gaatggttagcatcaagctaa-----------
A0A2I3M6I1_BCL2L11      aagttgtc----------gtgtag--------------------------
A0A2I3M6I1_BCL2L11      -gggtattttt-------gaataa--------------------------
A0A2I3M6I1_BCL2L11      agggtattttt-------gaataattaccaagcagccgaagaccacccac
A0A2I3M6I1_BCL2L11      agggtattttt-------gaataattaccaagcagccgaagaccacccac
A0A2I3M6I1_BCL2L11      agggtattttt-------gaataattaccaagcagccgaagaccacccac
A0A2I3M6I1_BCL2L11      aggatgtcgcttccacctgattaa--------------------------
A0A2I3M6I1_BCL2L11      aggttagag---------aaatag--------------------------
A0A2I3M6I1_BCL2L11      ------------------gactag--------------------------

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       tataaaaatgcaagaagatcagttaggaaattaaaggcttctagctttct
A0A096NTE9_BMF-02       cccctgacctggaatggggccgttgtcaaa--------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagg
A0A2I3M6I1_BCL2L11      aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagg
A0A2I3M6I1_BCL2L11      aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagg
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------

A0A096MPU8_PMAIP1-      -------------------
A0A096MPU8_PMAIP1-      -------------------
A0A096NKG5_BIK-01       -------------------
A0A096N944_HRK-01       -------------------
A0A2I3MCN5_BAD-03       -------------------
A0A2I3MCN5_BAD-02       -------------------
A0A2I3MCN5_BAD-04       -------------------
A0A2I3MCN5_BAD-01       -------------------
A0A2I3N2Z9_BBC3-03      -------------------
A0A096NTE9_BMF-01       cagctgccagcctgagtga
A0A096NTE9_BMF-02       ----------ccctgttga
A0A096NTE9_BMF-03       -------------------
A0A2I3M6I1_BCL2L11      -------------------
A0A2I3M6I1_BCL2L11      -------------------
A0A2I3M6I1_BCL2L11      -------------------
A0A2I3M6I1_BCL2L11      -------------------
A0A2I3M6I1_BCL2L11      atgcattga----------
A0A2I3M6I1_BCL2L11      atgcattga----------
A0A2I3M6I1_BCL2L11      atgcattga----------
A0A2I3M6I1_BCL2L11      -------------------
A0A2I3M6I1_BCL2L11      -------------------
A0A2I3M6I1_BCL2L11      -------------------

© 1998-2019