Dataset for CDS BMF of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096NTE9_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A096NTE9_BMF-03      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A096NTE9_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A096NTE9_BMF-01      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A096NTE9_BMF-03      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A096NTE9_BMF-02      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
                       **************************************************

A0A096NTE9_BMF-01      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A096NTE9_BMF-03      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A096NTE9_BMF-02      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
                       **************************************************

A0A096NTE9_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A096NTE9_BMF-03      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A096NTE9_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A096NTE9_BMF-01      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A096NTE9_BMF-03      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A096NTE9_BMF-02      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
                       **************************************************

A0A096NTE9_BMF-01      tgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgct
A0A096NTE9_BMF-03      tgccttgtggggtaactgaggaaccccagcgactcttttacg--------
A0A096NTE9_BMF-02      tgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgct
                       ******************************************        

A0A096NTE9_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
                                                                         

A0A096NTE9_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
                                                                         

A0A096NTE9_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
                                                                         

A0A096NTE9_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A096NTE9_BMF-03      ---caccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A096NTE9_BMF-02      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
                          ***********************************************

A0A096NTE9_BMF-01      gcacaaccttgctttgaatggagaagagaacaggaacggggtggacccta
A0A096NTE9_BMF-03      gcacaaccttgctttgaatggagaagagaacaggaacggggtggacccta
A0A096NTE9_BMF-02      gcacaaccttgctttgaatggagaagagaacaggaacggggtggacccta
                       **************************************************

A0A096NTE9_BMF-01      ggtataaaaatgcaagaagatcagttaggaaattaaaggcttctagcttt
A0A096NTE9_BMF-03      g-------------------------------------------------
A0A096NTE9_BMF-02      ggcccctgacctggaatggggccgttgtcaaa------------------
                       *                                                 

A0A096NTE9_BMF-01      ctcagctgccagcctgagtga
A0A096NTE9_BMF-03      ---------------------
A0A096NTE9_BMF-02      ------------ccctgttga
                                            

© 1998-2018