Dataset for CDS BCL2L11 of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3M6I1_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3M6I1_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2I3M6I1_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2I3M6I1_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2I3M6I1_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2I3M6I1_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2I3M6I1_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2I3M6I1_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2I3M6I1_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2I3M6I1_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2I3M6I1_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2I3M6I1_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **********************                            

A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3M6I1_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3M6I1_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3M6I1_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3M6I1_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                          

A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3M6I1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3M6I1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3M6I1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3M6I1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                                                                          

A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3M6I1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3M6I1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3M6I1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3M6I1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A2I3M6I1_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3M6I1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggat----
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3M6I1_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
                        ******************************************        

A0A2I3M6I1_BCL2L11      --------------------------ttctagaggatatag---------
A0A2I3M6I1_BCL2L11      -gaggccactggatcct---------ccctcggaatt-------------
A0A2I3M6I1_BCL2L11      -------------------------------agagaaatag---------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A2I3M6I1_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A2I3M6I1_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A2I3M6I1_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A2I3M6I1_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A2I3M6I1_BCL2L11      gg------------------------------------------------
                                                                          

A0A2I3M6I1_BCL2L11      --gtgatagttcattgtggtttggatttatatttactg--------gctt
A0A2I3M6I1_BCL2L11      --------gcccttcatagggaagttcagtggccactg------------
A0A2I3M6I1_BCL2L11      ------------------------------------------aggaagtt
A0A2I3M6I1_BCL2L11      ----------------------------------------------gggt
A0A2I3M6I1_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
A0A2I3M6I1_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
A0A2I3M6I1_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
A0A2I3M6I1_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggtt
A0A2I3M6I1_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggat
A0A2I3M6I1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3M6I1_BCL2L11      agattt-------gtatggccaccaccacagtcaagatacagaacaactc
A0A2I3M6I1_BCL2L11      -------------gaatggttagcatcaagctaa----------------
A0A2I3M6I1_BCL2L11      gtc----------gtgtag-------------------------------
A0A2I3M6I1_BCL2L11      attttt-------gaataa-------------------------------
A0A2I3M6I1_BCL2L11      attttt-------gaataattaccaagcagccgaagaccacccacaaatg
A0A2I3M6I1_BCL2L11      attttt-------gaataattaccaagcagccgaagaccacccacaaatg
A0A2I3M6I1_BCL2L11      attttt-------gaataattaccaagcagccgaagaccacccacaaatg
A0A2I3M6I1_BCL2L11      agag---------aaatag-------------------------------
A0A2I3M6I1_BCL2L11      gtcgcttccacctgattaa-------------------------------
A0A2I3M6I1_BCL2L11      -------------gactag-------------------------------
                                        *                                 

A0A2I3M6I1_BCL2L11      aaccacaaggatttctcatga-----------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      gttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgca
A0A2I3M6I1_BCL2L11      gttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgca
A0A2I3M6I1_BCL2L11      gttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgca
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3M6I1_BCL2L11      ----
A0A2I3M6I1_BCL2L11      ----
A0A2I3M6I1_BCL2L11      ----
A0A2I3M6I1_BCL2L11      ----
A0A2I3M6I1_BCL2L11      ttga
A0A2I3M6I1_BCL2L11      ttga
A0A2I3M6I1_BCL2L11      ttga
A0A2I3M6I1_BCL2L11      ----
A0A2I3M6I1_BCL2L11      ----
A0A2I3M6I1_BCL2L11      ----
                            

© 1998-2018