Dataset for CDS BAD of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3MCN5_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagatc
A0A2I3MCN5_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2I3MCN5_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2I3MCN5_BAD-04      atgttccagatcccagagtttgagcctagtgagcaggaagactccagatc
                       *********************************************** **

A0A2I3MCN5_BAD-03      tgcagagaggggcctgggccccagccccgcgggggacaagccctcagact
A0A2I3MCN5_BAD-02      tgcagagaggggcctgggccccagccccgcgggggacaagccctcagact
A0A2I3MCN5_BAD-01      tgcagagaggggcctgggccccagccccgcgggggacaagccctcagact
A0A2I3MCN5_BAD-04      tgcagagaggggcctgggccccagccccgcgggggacaagccctcagact

A0A2I3MCN5_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I3MCN5_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I3MCN5_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I3MCN5_BAD-04      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2I3MCN5_BAD-03      cagcaggagcagccaaccagcagcagccatcatggaggga----------
A0A2I3MCN5_BAD-02      cagcaggagcagccaaccagcagcagccatcatggagggagagcttggta
A0A2I3MCN5_BAD-01      cagcaggagcagccaaccagcagcagccatcatgg---------------
A0A2I3MCN5_BAD-04      cagcaggagcagccaaccagcagcagccatcatgg---------------

A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------

A0A2I3MCN5_BAD-03      ------------------------cttcctcgcccg--------------
A0A2I3MCN5_BAD-02      tcgcggaagcatcagcaccgatgtctgccccagccactgactcagaagcc
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------

A0A2I3MCN5_BAD-03      -------------------------aagagcgcgggc-acagcgacgcag
A0A2I3MCN5_BAD-02      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacgcgg
A0A2I3MCN5_BAD-01      -------------------------aggcgctggggctgtggagacgcgg
A0A2I3MCN5_BAD-04      -------------------------aggcgctggggctgtggagacgcgg
                                                * * **  ****    * ***** *

A0A2I3MCN5_BAD-03      atgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcg
A0A2I3MCN5_BAD-02      agtcgccacagctcctaccccgcgggga-----------cggaggaggac
A0A2I3MCN5_BAD-01      agtcgccacagctcctaccccgcgggga-----------cggaggaggac
A0A2I3MCN5_BAD-04      agtcgccacagctcctaccccgcgggga-----------cggaggaggac
                       *  ** ** ******  *    ** *              ** **     

A0A2I3MCN5_BAD-03      gaacttgggcaggggaagctccgccccctcc-cagtgaccttcgctccac
A0A2I3MCN5_BAD-02      gaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgc
A0A2I3MCN5_BAD-01      gaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgc
A0A2I3MCN5_BAD-04      gaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgc
                       ***     * *** * *** * ***** * *   *   *   ****** *

A0A2I3MCN5_BAD-03      gccccgaaactccacccgct------ctcactgtcctggtcggccatctt
A0A2I3MCN5_BAD-02      gcccc------ccaacctctgggcagcacagcgttatggccgcgagctcc
A0A2I3MCN5_BAD-01      gcccc------ccaacctctgggcagcacagcgttatggccgcgagctcc
A0A2I3MCN5_BAD-04      gcccc------ccaacctctgggcagcacagcgttatggccgcgagctcc
                       *****      *** ** **      * **  **  *** **        

A0A2I3MCN5_BAD-03      ggatatgggcggaagtgcttccctcaggccttatgcaaaagaggatccgt
A0A2I3MCN5_BAD-02      gga----ggatga-------------------------------------
A0A2I3MCN5_BAD-01      gga----ggatgagtgacgagtttgtggactcctttaagaagggacttcc
A0A2I3MCN5_BAD-04      gga----ggatgagtgacgagtttgtggactccttt---aagggacttcc
                       ***    **  **                                     

A0A2I3MCN5_BAD-03      gctccctctttcggtgggagggctgacccagattc---------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2I3MCN5_BAD-01      tcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccagct
A0A2I3MCN5_BAD-04      tcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccagct

A0A2I3MCN5_BAD-03      ---------ccttccggtgcatgtga------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2I3MCN5_BAD-01      ggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagc
A0A2I3MCN5_BAD-04      ggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagc

A0A2I3MCN5_BAD-03      ------------------
A0A2I3MCN5_BAD-02      ------------------
A0A2I3MCN5_BAD-01      tccgccccctcccagtga
A0A2I3MCN5_BAD-04      tccgccccctcccagtga

© 1998-2019