Dataset for CDS PMAIP1 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3SX38_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc
A0A2I3SX38_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc
                        **************************************************

A0A2I3SX38_PMAIP1-      tccagcaggaccggcgggtacggcgagggaccaagccggatttgggattg
A0A2I3SX38_PMAIP1-      tccagcag------------------------------------------
                        ********                                          

A0A2I3SX38_PMAIP1-      ggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctctt
A0A2I3SX38_PMAIP1-      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      tcctcctggccacttgcccttccccgggggcacgaggaacaagtgcaagt
A0A2I3SX38_PMAIP1-      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      agctggaagtcgagtgtgctactcaactcaggagatttggagacaaactg
A0A2I3SX38_PMAIP1-      agctggaagtcgagtgtgctactcaactcaggagatttggagacaaactg
                        **************************************************

A0A2I3SX38_PMAIP1-      aacttccggcagaaacttctgaatctgatatccaaactcttctgctcagg
A0A2I3SX38_PMAIP1-      aacttccggcagaaacttctgaatctgatatccaaactcttctgctcagg
                        **************************************************

A0A2I3SX38_PMAIP1-      aacctgactgcatcaaaaacttgcatgaggggactccttcaaaagagttt
A0A2I3SX38_PMAIP1-      aacctga-------------------------------------------
                        *******                                           

A0A2I3SX38_PMAIP1-      tctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaatt
A0A2I3SX38_PMAIP1-      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      gg
A0A2I3SX38_PMAIP1-      --
                          

© 1998-2018