Dataset for CDS classical BH3-containing proteins of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2QLU7_BIK-01           atg--------------------------tctgaagtaagacccc----t
A0A2I3SX38_PMAIP1-      atg--------------------------------------cctggg---
A0A2I3SX38_PMAIP1-      atg--------------------------------------cctggg---
A0A2I3TBK7_BAD-01       atg------------------ttccagatcccagagtttgagccgag--t
A0A2I3TBK7_BAD-02       atg------------------ttccagatcccagagtttgagccgag--t
A0A2I3TBK7_BAD-03       atg------------------ttccagatcccagagtttgagccgag--t
H2Q6Y8_HRK-01           atg----------------------------------------------t
A0A2I3RGH5_BBC3-03      atg-----------------------------aaatttggcatggggtct
A0A2I3RIG5_BBC3-02      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
A0A2J8QDD5_BMF-02       atg--------------g---agccatc-------------tcagtgtgt
A0A2J8QDD5_BMF-01       atg--------------g---agccatc-------------tcagtgtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
A0A2J8JCT2_BCL2L11      atg--------------gcaaagcaaccttctgatgtaagttctgagtgt
                        ***                                               

H2QLU7_BIK-01           ctccagagacatcttgatggagaccctcctgtatgagcagctcctggaac
A0A2I3SX38_PMAIP1-      ----aagaaggcgcgcaagaacgctcaac-----------------cgag
A0A2I3SX38_PMAIP1-      ----aagaaggcgcgcaagaacgctcaac-----------------cgag
A0A2I3TBK7_BAD-01       gagcaggaagactc-----------cagctctgcagagaggggcctgggc
A0A2I3TBK7_BAD-02       gagcaggaagactc-----------cagctctgcagagaggggcctgggc
A0A2I3TBK7_BAD-03       gagcaggaagactc-----------cagctctgcagagaggggcctgggc
H2Q6Y8_HRK-01           gccc----gtgccc----------cctgcaccgc-------ggccgcgac
A0A2I3RGH5_BBC3-03      gcccaggcatgtcc-------------------a-------tgccaggtg
A0A2I3RIG5_BBC3-02      ggcccgcgacggcccgcgccccttcccgctcggc-------cgcctggtg
A0A2J8QDD5_BMF-02       ggaggagctggaggatgatgtgttccaac-cagaggatggggagccggtg
A0A2J8QDD5_BMF-01       ggaggagctggaggatgatgtgttccaac-cagaggatggggagccggtg
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa----ttgcagc-ctgcggagaggcctccccag
                                                                          

H2QLU7_BIK-01           ccccgaccatggaggttcttggcgtgactgactctgaag-----------
A0A2I3SX38_PMAIP1-      ccccgcgc-gg------------------gctccagcag-----------
A0A2I3SX38_PMAIP1-      ccccgcgc-gg------------------gctccagcag-----------
A0A2I3TBK7_BAD-01       cccagccc-cgcaggggacgggccctcaggctccggcaa-----------
A0A2I3TBK7_BAD-02       cccagccc-cgcaggggacgggccctcaggctccggcaa-----------
A0A2I3TBK7_BAD-03       cccagccc-cgcaggggacgggccctcaggctccggcaa-----------
H2Q6Y8_HRK-01           cccc----------cggccgtgt------gcgcctgcag-----------
A0A2I3RGH5_BBC3-03      ccca----------gg----------gctgcttccgcga-----------
A0A2I3RIG5_BBC3-02      ccct----------cggcagtgtcctgcggcctctgcgagcccggcctgg
A0A2J8QDD5_BMF-02       acccaacc-cg--------gga--gcttgctctctgctg-----------
A0A2J8QDD5_BMF-01       acccaacc-cg--------gga--gcttgctctctgctg-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
A0A2J8JCT2_BCL2L11      ctcagacc-tg--------gggcccctacctccctacag-----------
                          *                              *                

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      ctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcc
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
                                                                          

H2QLU7_BIK-01           ---------------------------aggacctggaccctatggaggac
A0A2I3SX38_PMAIP1-      ----------gaccggcgggtacggcgagggaccaagccggatttgggat
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       ----------------gcatcatcgccaggccccaggcctcctgtgggac
A0A2I3TBK7_BAD-02       ----------------gcatcatcgccaggccccaggcctcctgtgggac
A0A2I3TBK7_BAD-03       ----------------gcatcatcgccaggccccaggcctcctgtgggac
H2Q6Y8_HRK-01           -------------------------------cgcgggtcgcctg--gggc
A0A2I3RGH5_BBC3-03      -------------------------------cgtgggtcccctgccagat
A0A2I3RIG5_BBC3-02      cccaccgccccacccgccgtcaccgccgccctggggggtccccgctggcc
A0A2J8QDD5_BMF-02       ---------------------acctgtttgcccagagcctactg--g---
A0A2J8QDD5_BMF-01       ---------------------acctgtttgcccagagcctactg--g---
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--g---
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--g---
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--g---
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--ggta
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--ggta
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-aca-------
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--ggta
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--ggta
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--ggta
A0A2J8JCT2_BCL2L11      ---------------------a----------cagagcc-acaa--ggta
                                                                          

H2QLU7_BIK-01           t---------tcgattctttggagtgcatggagggcagtgacgcgttggc
A0A2I3SX38_PMAIP1-      tgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctc
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       g-------------------------------------------------
A0A2I3TBK7_BAD-02       g-------------------------------------------------
A0A2I3TBK7_BAD-03       g-------------------------------------------------
H2Q6Y8_HRK-01           t-------------------------------------------------
A0A2I3RGH5_BBC3-03      ttg------------------------------------tggtcctcagc
A0A2I3RIG5_BBC3-02      tgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagc
A0A2J8QDD5_BMF-02       ---------------------------------actgccccctcagccga
A0A2J8QDD5_BMF-01       ---------------------------------actgccccctcagccga
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      atcctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2J8JCT2_BCL2L11      atcctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      atcctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2J8JCT2_BCL2L11      atcctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2J8JCT2_BCL2L11      atcctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2J8JCT2_BCL2L11      atcctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
                                                                          

H2QLU7_BIK-01           cctgcggctggcc--------------------------tgcatcgggga
A0A2I3SX38_PMAIP1-      tttcctcctggccacttgcccttccccgggggcacgaggaacaagtgcaa
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       ----ccagtcacc--------------------------agcaggagcag
A0A2I3TBK7_BAD-02       ----ccagtcacc--------------------------agcaggagcag
A0A2I3TBK7_BAD-03       ----ccagtcacc--------------------------agcaggagcag
H2Q6Y8_HRK-01           ----gcgctcgtc--------------------------cgc-cgcgcag
A0A2I3RGH5_BBC3-03      cctcgctctcgct--------------------------ggc-ggagcag
A0A2I3RIG5_BBC3-02      cctcgctctcgct--------------------------ggc-ggagcag
A0A2J8QDD5_BMF-02       cttcagctcttcc--------------------------ctctcacccac
A0A2J8QDD5_BMF-01       cttcagctcttcc--------------------------ctctcacccac
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      cctcag---ggcc--------------------------cgctggcccca
A0A2J8JCT2_BCL2L11      cctcag---ggcc--------------------------cgctggcccca
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      cctcag---ggcc--------------------------cgctggcccca
A0A2J8JCT2_BCL2L11      cctcag---ggcc--------------------------cgctggcccca
A0A2J8JCT2_BCL2L11      cctcag---ggcc--------------------------cgctggcccca
A0A2J8JCT2_BCL2L11      cctcag---ggcc--------------------------cgctggcccca
                                                                          

H2QLU7_BIK-01           cgagatggacgtgagcctcagggccccacgcctggc--------------
A0A2I3SX38_PMAIP1-      gtagctggaagtcgag--tgtgctactcaact------------------
A0A2I3SX38_PMAIP1-      --agctggaagtcgag--tgtgctactcaact------------------
A0A2I3TBK7_BAD-01       ccaaccagcagcagccatcatggagaagggacttcctcgccc--------
A0A2I3TBK7_BAD-02       ccaaccagcagcagccatcatg----------------------------
A0A2I3TBK7_BAD-03       ccaaccagcagcagccatcatggagggagaacttcgtattctccttcttg
H2Q6Y8_HRK-01           ctcacc----gccgcc--cg-gctcaaggcgc------------------
A0A2I3RGH5_BBC3-03      --cacctggagtcgcc--cgtgcccagcgccc------------------
A0A2I3RIG5_BBC3-02      --cacctggagtcgcc--cgtgcccagcgccc------------------
A0A2J8QDD5_BMF-02       tgctgtggccctggccttc-------------------------------
A0A2J8QDD5_BMF-01       tgctgtggccctggccttc-------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2J8JCT2_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2J8JCT2_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2J8JCT2_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2J8JCT2_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
                                                                          

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       ggaatctgaggactctgaaaatcccagtgcagggatgcttgcggaagcat
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2J8JCT2_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2J8JCT2_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2J8JCT2_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2J8JCT2_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
                                                                          

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       cagcagggatgtccgccccagccgctgactcagaagcccaacacgcagag
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-02       -----------gacccaccagc----------------------------
A0A2J8QDD5_BMF-01       -----------gacccaccagc----------------------------
A0A2J8JCT2_BCL2L11      ------acaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      ------acaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      acacagacaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      acacagacaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      ----agacaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      acacagacaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      acacagacaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      acacagacaggagcccagcacc----------------------------
A0A2J8JCT2_BCL2L11      acacagacaggagcccagcacc----------------------------
                                                                          

H2QLU7_BIK-01           ------------ccagctctccgac-gtggccatgcacagcctgggtctg
A0A2I3SX38_PMAIP1-      ------------caggagatttgg---agacaaactgaac----------
A0A2I3SX38_PMAIP1-      ------------caggagatttgg---agacaaactgaac----------
A0A2I3TBK7_BAD-01       ------------gaagagcgcgggc-acagcaacccagatgc--------
A0A2I3TBK7_BAD-02       ------------gaggcgctggggctgtggagatccggagtc--------
A0A2I3TBK7_BAD-03       aatgtaaagctagaggcgctggggctgtggagatccggagtc--------
H2Q6Y8_HRK-01           ------------tagg-----cgac--gagctgcaccagcgc--------
A0A2I3RGH5_BBC3-03      ------------cgggggctctggc--gggcggtccca------------
A0A2I3RIG5_BBC3-02      ------------cgggggctctggc--gggcggtccca------------
A0A2J8QDD5_BMF-02       ------------caggaa----gac-aaagctacccagaccctcagccca
A0A2J8QDD5_BMF-01       ------------caggaa----gac-aaagctacccagaccctcagccca
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
A0A2J8JCT2_BCL2L11      ------------catgagttgtgac-aaatcaacacaaaccccaagtcct
                                                                          

H2QLU7_BIK-01           gctttca---tcta-----cgaccagactgaggacatcagggatgttctt
A0A2I3SX38_PMAIP1-      ----------ttccggcagaaact--tctgaatct---------------
A0A2I3SX38_PMAIP1-      ----------ttccggcagaaact--tctgaatct---------------
A0A2I3TBK7_BAD-01       ----------ggca-----aagct--cca--gct------ggacgc----
A0A2I3TBK7_BAD-02       ----------gcca-----cagct--cct--accccgcggggacgg----
A0A2I3TBK7_BAD-03       ----------gcca-----cagct--cct--accccgcggggacgg----
H2Q6Y8_HRK-01           ----------accatgtggcggcg--ccg------cgcgcggagcc----
A0A2I3RGH5_BBC3-03      ----------ccca---ggcggcc--ccgggagtccgcggggagga----
A0A2I3RIG5_BBC3-02      ----------ccca---ggcggcc--ccgggagtccgcggggagga----
A0A2J8QDD5_BMF-02       gcct------cccc-----cagcc--aaggtgtcatgctgccttgt----
A0A2J8QDD5_BMF-01       gcct------cccc-----cagcc--aaggtgtcatgctgccttgt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
A0A2J8JCT2_BCL2L11      ccttgccaggcctt-----caacc--actatctca---------gt----
                                                                          

H2QLU7_BIK-01           agaagtttcatggacggtttcaccacacttaaggagaacataatgaggtt
A0A2I3SX38_PMAIP1-      ---------------------------------gatatcca---------
A0A2I3SX38_PMAIP1-      ---------------------------------gatatcca---------
A0A2I3TBK7_BAD-01       ---------------gagtcttccagtcctggtgggatcggaacttgggc
A0A2I3TBK7_BAD-02       ---------------aggacgac-------gaagggatggg---------
A0A2I3TBK7_BAD-03       ---------------aggacgac-------gaagggatggg---------
H2Q6Y8_HRK-01           ---------------gga-----gggcgccg--gcgcccgg---------
A0A2I3RGH5_BBC3-03      ---------------ggaacagtgggcccgg--gagatcgg---------
A0A2I3RIG5_BBC3-02      ---------------ggaacagtgggcccgg--gagatcgg---------
A0A2J8QDD5_BMF-02       ---------------ggggtgact-------gaggaacccc---------
A0A2J8QDD5_BMF-01       ---------------ggggtgact-------gaggaacccc---------
A0A2J8JCT2_BCL2L11      ---------------gcaatggtagtcatcctagaggatat---------
A0A2J8JCT2_BCL2L11      ---------------gcaatgg-----at------gactcc---------
A0A2J8JCT2_BCL2L11      ----------------------cttccat------gaggca---------
A0A2J8JCT2_BCL2L11      ---------------gcaatggtt--------------------------
A0A2J8JCT2_BCL2L11      ---------------gcaat------------------------------
A0A2J8JCT2_BCL2L11      ---------------gcaatggcttccat------gaggca---------
A0A2J8JCT2_BCL2L11      ---------------gcaatggcttccat------gaggca---------
A0A2J8JCT2_BCL2L11      ---------------gcaatggcttccat------gaggca---------
A0A2J8JCT2_BCL2L11      ---------------gcaatggcttccat------gaggca---------
A0A2J8JCT2_BCL2L11      ---------------gcaatggct--------------------------
                                                                          

H2QLU7_BIK-01           ctggagatccccgaac----------------------------------
A0A2I3SX38_PMAIP1-      ------aactcttctg----------------------------------
A0A2I3SX38_PMAIP1-      ------aactcttctg----------------------------------
A0A2I3TBK7_BAD-01       aggggaagctccgccc----------------------------------
A0A2I3TBK7_BAD-02       -ggaggagcccagccc----------------------------------
A0A2I3TBK7_BAD-03       -ggaggagcccagccc----------------------------------
H2Q6Y8_HRK-01           -cgcgctccccaccta----------------------------------
A0A2I3RGH5_BBC3-03      -gg-----cccagctg----------------------------------
A0A2I3RIG5_BBC3-02      -gg-----cccagctg----------------------------------
A0A2J8QDD5_BMF-02       -agcgactcttttatggcaatgctggctatcggcttcctctccctgccag
A0A2J8QDD5_BMF-01       -agcgactcttttatg----------------------------------
A0A2J8JCT2_BCL2L11      -aggtgatctttcact----------------------------------
A0A2J8JCT2_BCL2L11      -gctggatcct---------------------------------------
A0A2J8JCT2_BCL2L11      -ggctgaacctgcaga----------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      -ggctgaacctgcaga----------------------------------
A0A2J8JCT2_BCL2L11      -ggctgaacctgcaga----------------------------------
A0A2J8JCT2_BCL2L11      -ggctgaacctgcaga----------------------------------
A0A2J8JCT2_BCL2L11      -ggctgaacctgcaga----------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
                                                                          

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-02       tttcccagcagtcttgcccattggggagcagccccccgaagggcagtggc
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
                                                                          

H2QLU7_BIK-01           -------------------------cccgggtcctgggtgtcccgcgaac
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       ----------------------cctcc-cagtgaccttcgctccacatcc
A0A2I3TBK7_BAD-02       ----------------------ctttcggggccgctcgcgctcggcgccc
A0A2I3TBK7_BAD-03       ----------------------ctttcggggccgctcgcgctcggcgccc
H2Q6Y8_HRK-01           ----------------------c-------------tggccttggc----
A0A2I3RGH5_BBC3-03      ----------------------cggcggatggcggacgacctcaacgcgc
A0A2I3RIG5_BBC3-02      ----------------------cggcggatggcggacgacctcaacgcgc
A0A2J8QDD5_BMF-02       aacatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagac
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8JCT2_BCL2L11      -gtgctttggatttatatttactggcttagatttgtatggc---------
A0A2J8JCT2_BCL2L11      -----------------------ccctcagaattgccctt----------
A0A2J8JCT2_BCL2L11      -tatgcgaccggagatatggatcgcccaagagttgcggcg----------
A0A2J8JCT2_BCL2L11      ----------agagaaatag------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      -tatgcgaccggagatatggatcgcccaagagttgcggcg----------
A0A2J8JCT2_BCL2L11      -tatgcgaccggagatatggatcgcccaagagttgcggcg----------
A0A2J8JCT2_BCL2L11      -tatgcgaccggagatatggatcgcccaagagttgcggcg----------
A0A2J8JCT2_BCL2L11      -tatgcgaccggagatatggatcgcccaagagttgcggcg----------
A0A2J8JCT2_BCL2L11      ------aactgg--------------------------------------
                                                                          

H2QLU7_BIK-01           aggtgctgctggcgctgctgctgctgctggcgctgctgct----------
A0A2I3SX38_PMAIP1-      -------------------------------ctcaggaacctgactgcat
A0A2I3SX38_PMAIP1-      -------------------------------ctcaggaacctga------
A0A2I3TBK7_BAD-01       cgaaactccacccgttcccactgccctgggcagc-catcttgaatatggg
A0A2I3TBK7_BAD-02       cccaac-----------------ctctgggcagcacagc---gctatggc
A0A2I3TBK7_BAD-03       cccaac-----------------ctctgggcagcacagc---gctatggc
H2Q6Y8_HRK-01           ------------------------tgtgcgcggccgcgca--ggtggcgg
A0A2I3RGH5_BBC3-03      a----------------------gtacgagcggcggagac--aagaggag
A0A2I3RIG5_BBC3-02      a----------------------gtacgagcggcggagac--aagaggag
A0A2J8QDD5_BMF-02       cagttccaccggcttcatgtgcagcaacaccagcagaacc--aaaatcgt
A0A2J8QDD5_BMF-01       ---------------------------caccagcagaacc--aaaatcgt
A0A2J8JCT2_BCL2L11      ---------------------------caccaccatagtc--aagatgc-
A0A2J8JCT2_BCL2L11      ------------------------------cataggg-----aagttca-
A0A2J8JCT2_BCL2L11      ------------------------------tatcggagac--gagttta-
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ------------------------------tatcggagac--gagttta-
A0A2J8JCT2_BCL2L11      ------------------------------tatcggagac--gagttta-
A0A2J8JCT2_BCL2L11      ------------------------------tatcggagac--gagttta-
A0A2J8JCT2_BCL2L11      ------------------------------tatcggagac--gagttta-
A0A2J8JCT2_BCL2L11      --------------------------------------------------
                                                                          

H2QLU7_BIK-01           ------------------gccgctgctcagcgggggcctgcacctgctgc
A0A2I3SX38_PMAIP1-      caaaaacttgcatgaggggactccttcaaaagagttttctcaggaggtgc
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       cggaagtacttccctcaggcctatgcaaaaagaggatccgtgctgtctcc
A0A2I3TBK7_BAD-02       cgcgag-------ctccggaggatgagtgacgag----tttgtggactcc
A0A2I3TBK7_BAD-03       cgcgag-------ctccggaggatga------------------------
H2Q6Y8_HRK-01           cgctggcgg----cctggctgctcggc-----------------------
A0A2I3RGH5_BBC3-03      cagcagcgg----caccgcccctcgccctggagggtcctgtacaatctca
A0A2I3RIG5_BBC3-02      cagcagcgg----caccgcccctcgccctggagggtcctgtacaatctca
A0A2J8QDD5_BMF-02       gtgtggtggcagatcctcctcttcctgcacaaccttgctttgaatggaga
A0A2J8QDD5_BMF-01       gtgtggtggcagatcctcctcttcctgcacaaccttgctttgaatggaga
A0A2J8JCT2_BCL2L11      ------------------------------agaacaactcaaccacaagg
A0A2J8JCT2_BCL2L11      ------------------------------gtggccactc----aagtgg
A0A2J8JCT2_BCL2L11      ------------------------------acgcttactatgcaaggagg
A0A2J8JCT2_BCL2L11      --------------------------------------------aggaag
A0A2J8JCT2_BCL2L11      ------------------------------------------------gg
A0A2J8JCT2_BCL2L11      ------------------------------acgcttactatgcaaggagg
A0A2J8JCT2_BCL2L11      ------------------------------acgcttactatgcaaggagg
A0A2J8JCT2_BCL2L11      ------------------------------acgcttactatgcaaggagg
A0A2J8JCT2_BCL2L11      ------------------------------acgcttactatgcaaggagg
A0A2J8JCT2_BCL2L11      --------------------------------------------------
                                                                          

H2QLU7_BIK-01           tcaagtga------------------------------------------
A0A2I3SX38_PMAIP1-      acgtttcatcaatttgaagaa-----------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       tttgg----------agggag-----------------------------
A0A2I3TBK7_BAD-02       tttaa----------gaagggacttcctcgcccgaagagcgcgggcacag
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      tcatg----------ggactcctgcccttacccaggggccacagagcccc
A0A2I3RIG5_BBC3-02      tcatg----------ggactcctgcccttacccaggggccacagagcccc
A0A2J8QDD5_BMF-02       aga------------gaacag-----------------------------
A0A2J8QDD5_BMF-01       aga------------gaacag-----------------------------
A0A2J8JCT2_BCL2L11      atttc----------tcatga-----------------------------
A0A2J8JCT2_BCL2L11      tta------------gcaaaa-----------------------------
A0A2J8JCT2_BCL2L11      ctg------------gcaaaa-----------------------------
A0A2J8JCT2_BCL2L11      ttgtc----------gtgtag-----------------------------
A0A2J8JCT2_BCL2L11      gtattttt-------gaataa-----------------------------
A0A2J8JCT2_BCL2L11      gtattttt-------gaataattaccaagcagccgaagaccacccacgaa
A0A2J8JCT2_BCL2L11      gtattttt-------gaataattaccaagcagccgaagaccacccacgaa
A0A2J8JCT2_BCL2L11      tt---------agagaaatag-----------------------------
A0A2J8JCT2_BCL2L11      atgcctcttccacctgattaa-----------------------------
A0A2J8JCT2_BCL2L11      ---------------gactag-----------------------------
                                                                          

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      ---------------------agactgcattgtaattgg-----------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3TBK7_BAD-01       -----------------------ggctgaccccgattc------------
A0A2I3TBK7_BAD-02       caacccagatgcggcaaagctccagctggacgcgagtcttccagtcctgg
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --a--------------------ggcggaacttg--tag-----------
A0A2I3RGH5_BBC3-03      cga--------------------gatggagcccaattag-----------
A0A2I3RIG5_BBC3-02      cga--------------------gatggagcccaattag-----------
A0A2J8QDD5_BMF-02       -----------------gaacggggcaggccctaggtga-----------
A0A2J8QDD5_BMF-01       -----------------gaacggggcaggccctag---------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ------------------------------tcaagctaa-----------
A0A2J8JCT2_BCL2L11      ------------------ctcctggcatcctccacctga-----------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      tggttatcttacgactgttacgttacattgtccgcctggtgtggagaatg
A0A2J8JCT2_BCL2L11      tggttatcttacgactgttacgttacattgtccgcctggtgtggagaatg
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
                                                                          

H2QLU7_BIK-01           ---------------------------------------------
A0A2I3SX38_PMAIP1-      ---------------------------------------------
A0A2I3SX38_PMAIP1-      ---------------------------------------------
A0A2I3TBK7_BAD-01       ----------------------------ccttccggtgcgtgtga
A0A2I3TBK7_BAD-02       tgggatcggaacttgggcaggggaagctccgccccctcccagtga
A0A2I3TBK7_BAD-03       ---------------------------------------------
H2Q6Y8_HRK-01           ---------------------------------------------
A0A2I3RGH5_BBC3-03      ---------------------------------------------
A0A2I3RIG5_BBC3-02      ---------------------------------------------
A0A2J8QDD5_BMF-02       ---------------------------------------------
A0A2J8QDD5_BMF-01       ---------------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
A0A2J8JCT2_BCL2L11      cattga---------------------------------------
A0A2J8JCT2_BCL2L11      cattga---------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
A0A2J8JCT2_BCL2L11      ---------------------------------------------
                                                                     

© 1998-2018