Dataset for CDS BMF of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2J8QDD5_BMF-01      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaacc
A0A2J8QDD5_BMF-02      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaacc

A0A2J8QDD5_BMF-01      agaggatggggagccggtgacccaacccgggagcttgctctctgctgacc
A0A2J8QDD5_BMF-02      agaggatggggagccggtgacccaacccgggagcttgctctctgctgacc

A0A2J8QDD5_BMF-01      tgtttgcccagagcctactggactgccccctcagccgacttcagctcttc
A0A2J8QDD5_BMF-02      tgtttgcccagagcctactggactgccccctcagccgacttcagctcttc

A0A2J8QDD5_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2J8QDD5_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga

A0A2J8QDD5_BMF-01      caaagctacccagaccctcagcccagcctcccccagccaaggtgtcatgc
A0A2J8QDD5_BMF-02      caaagctacccagaccctcagcccagcctcccccagccaaggtgtcatgc

A0A2J8QDD5_BMF-01      tgccttgtggggtgactgaggaaccccagcgactcttttatg--------
A0A2J8QDD5_BMF-02      tgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct

A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      ggctatcggcttcctctccctgccagtttcccagcagtcttgcccattgg

A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg

A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag

A0A2J8QDD5_BMF-01      ---caccagcagaaccaaaatcgtgtgtggtggcagatcctcctcttcct
A0A2J8QDD5_BMF-02      caacaccagcagaaccaaaatcgtgtgtggtggcagatcctcctcttcct

A0A2J8QDD5_BMF-01      gcacaaccttgctttgaatggagaagagaacaggaacggggcaggcccta
A0A2J8QDD5_BMF-02      gcacaaccttgctttgaatggagaagagaacaggaacggggcaggcccta

A0A2J8QDD5_BMF-01      g----
A0A2J8QDD5_BMF-02      ggtga

© 1998-2018