Dataset for CDS BBC3 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3RGH5_BBC3-03      atg-----------------------------aaatttggcatggggtct
A0A2I3RIG5_BBC3-02      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
                        ***                               *    * *  *** **

A0A2I3RGH5_BBC3-03      gcccaggcatgtcc-------------------atgccaggtgcccagg-
A0A2I3RIG5_BBC3-02      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctcgg
                        * ** *  * * **                     *** *******  * 

A0A2I3RGH5_BBC3-03      ---------gctgcttccgcga----------------------------
A0A2I3RIG5_BBC3-02      cagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgccgcc
                                 ** ** ** ****                            

A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      cccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgc
                                                                          

A0A2I3RGH5_BBC3-03      --------------cgtgggtcccctgccagatttg--------------
A0A2I3RIG5_BBC3-02      cgtcaccgccgccctggggggtccccgctggcctgggggtccccgcagcc
                                       * ***  *** **  *  * *              

A0A2I3RGH5_BBC3-03      ----------------------tggtcctcagccctcgctctcgctggcg
A0A2I3RIG5_BBC3-02      ggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcg
                                               ***************************

A0A2I3RGH5_BBC3-03      gagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcggg
A0A2I3RIG5_BBC3-02      gagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcggg
                        **************************************************

A0A2I3RGH5_BBC3-03      cggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
A0A2I3RIG5_BBC3-02      cggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
                        **************************************************

A0A2I3RGH5_BBC3-03      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg
A0A2I3RIG5_BBC3-02      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg
                        **************************************************

A0A2I3RGH5_BBC3-03      cagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgcc
A0A2I3RIG5_BBC3-02      cagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgcc
                        **************************************************

A0A2I3RGH5_BBC3-03      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
A0A2I3RIG5_BBC3-02      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
                        **************************************************

A0A2I3RGH5_BBC3-03      gccacagagcccccgagatggagcccaattag
A0A2I3RIG5_BBC3-02      gccacagagcccccgagatggagcccaattag
                        ********************************

© 1998-2018