Dataset for CDS BAD of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3TBK7_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I3TBK7_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I3TBK7_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
                       **************************************************

A0A2I3TBK7_BAD-01      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I3TBK7_BAD-02      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I3TBK7_BAD-03      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
                       **************************************************

A0A2I3TBK7_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I3TBK7_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I3TBK7_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
                       **************************************************

A0A2I3TBK7_BAD-01      cagcaggagcagccaaccagcagcagccatcatggagaagggacttcctc
A0A2I3TBK7_BAD-02      cagcaggagcagccaaccagcagcagccatcatg----------------
A0A2I3TBK7_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggagaacttcgta
                       **********************************                

A0A2I3TBK7_BAD-01      gccc----------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc
                                                                         

A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-03      ttgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
                                                                         

A0A2I3TBK7_BAD-01      ------------------------gaagagcgcgggc-acagcaacccag
A0A2I3TBK7_BAD-02      ------------------------gaggcgctggggctgtggagatccgg
A0A2I3TBK7_BAD-03      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
                                               ** * **  ****    *  * ** *

A0A2I3TBK7_BAD-01      atgcggcaaagctccagct------ggacgcgagtcttccagtcctggtg
A0A2I3TBK7_BAD-02      agtcgccacagctcctaccccgcggggacggaggacgac-------gaag
A0A2I3TBK7_BAD-03      agtcgccacagctcctaccccgcggggacggaggacgac-------gaag
                       *  ** ** ******  *       *****   * *  *       *  *

A0A2I3TBK7_BAD-01      ggatcggaacttgggcaggggaagctccgccccctcc-cagtgaccttcg
A0A2I3TBK7_BAD-02      ggatggg----------ggaggagcccagcccctttcggggccgctcgcg
A0A2I3TBK7_BAD-03      ggatggg----------ggaggagcccagcccctttcggggccgctcgcg
                       **** **          ** * *** * ***** * *   *   *   **

A0A2I3TBK7_BAD-01      ctccacatcccgaaactccacccgttcccactgccctgggcagc-catct
A0A2I3TBK7_BAD-02      ctcggcgccccccaac-----------------ctctgggcagcacagc-
A0A2I3TBK7_BAD-03      ctcggcgccccccaac-----------------ctctgggcagcacagc-
                       ***  *  ***  ***                 * ********* ** * 

A0A2I3TBK7_BAD-01      tgaatatgggcggaagtacttccctcaggcctatgcaaaaagaggatccg
A0A2I3TBK7_BAD-02      --gctatggccgcgag-------ctccggaggatgagtgacgag----tt
A0A2I3TBK7_BAD-03      --gctatggccgcgag-------ctccggaggatga--------------
                           ***** **  **       *** **   ***               

A0A2I3TBK7_BAD-01      tgctgtctcctttggagggag-----------------------------
A0A2I3TBK7_BAD-02      tgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacag
A0A2I3TBK7_BAD-03      --------------------------------------------------
                                                                         

A0A2I3TBK7_BAD-01      -----------------------ggctgaccccgattc------------
A0A2I3TBK7_BAD-02      caacccagatgcggcaaagctccagctggacgcgagtcttccagtcctgg
A0A2I3TBK7_BAD-03      --------------------------------------------------
                                                                         

A0A2I3TBK7_BAD-01      ----------------------------ccttccggtgcgtgtga
A0A2I3TBK7_BAD-02      tgggatcggaacttgggcaggggaagctccgccccctcccagtga
A0A2I3TBK7_BAD-03      ---------------------------------------------
                                                                    

© 1998-2018