Dataset for CDS classical BH3-containing proteins of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

19 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R8ZXD2_BIK-01       atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
A0A2R9AKC9_PMAIP1-      atg-----------------------------------------------
A0A2R9AKC9_PMAIP1-      atg-----------------------------------------------
A0A2R9BS98_BMF-02       atgg--------------------agccatc----------------tca
A0A2R9BS98_BMF-01       atgg--------------------agccatc----------------tca
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9CA99_BCL2L11      atggcaa-----------------agcaaccttctgat---gtaagttct
A0A2R9BZA9_BBC3-01      atga------------------------aatttggcatggggtctgccca
A0A2R8Z697_BAD-02       atg---------------------------ttccagat--------ccca
A0A2R8Z697_BAD-03       atg---------------------------ttccagat--------ccca
A0A2R8Z697_BAD-01       atg---------------------------ttccagat--------ccca

A0A2R8ZXD2_BIK-01       -----gtatgagcagctcctggaacccccgaccatggaggttcttggcgt
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       gt---gtgtgga---------------g-----gagctggaggatgatgt
A0A2R9BS98_BMF-01       gt---gtgtgga---------------g-----gagctggaggatgatgt
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9CA99_BCL2L11      ga---gtgtgac---------------c-----gagaaggtagacaa---
A0A2R9BZA9_BBC3-01      ggcatgtccatg---------------ccaggtgcccagggctgc-----
A0A2R8Z697_BAD-02       ga---gtttgag---------------ccgagtgagcaggaagac-----
A0A2R8Z697_BAD-03       ga---gtttgag---------------ccgagtgagcaggaagac-----
A0A2R8Z697_BAD-01       ga---gtttgag---------------ccgagtgagcaggaagac-----

A0A2R8ZXD2_BIK-01       gactgagtctgaggaggacctggaccctatggaggacttcgattctttgg
A0A2R9AKC9_PMAIP1-      -------cctgggaagaa---ggcgc----gcaagaacgctcaaccgagc
A0A2R9AKC9_PMAIP1-      -------cctgggaagaa---ggcgc----gcaagaacgctcaaccgagc
A0A2R9BS98_BMF-02       gttccaaccagaggatgg---ggagc-------------cggtgacccaa
A0A2R9BS98_BMF-01       gttccaaccagaggatgg---ggagc-------------cggtgacccaa
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9CA99_BCL2L11      -ttgcagcctgcggagag---gcctc-------------cccagctcaga
A0A2R9BZA9_BBC3-01      -t-----tccgtgacgtg---ggtcccctgccagatttgtggtcctcagc
A0A2R8Z697_BAD-02       -tccagctctgcagagag---gggcc-------------tgggccccagc
A0A2R8Z697_BAD-03       -tccagctctgcagagag---gggcc-------------tgggccccagc
A0A2R8Z697_BAD-01       -tccagctctgcagagag---gggcc-------------tgggccccagc
                                * *          *   *                        

A0A2R8ZXD2_BIK-01       agtgcatggagggcagtgacgcgttggccctgcggctggcctgcatcggg
A0A2R9AKC9_PMAIP1-      ccc-------------------------gcgcgggct--cc---------
A0A2R9AKC9_PMAIP1-      ccc-------------------------gcgcgggct--cc---------
A0A2R9BS98_BMF-02       ccc---------g------------gga--gcttgctctct---------
A0A2R9BS98_BMF-01       ccc---------g------------gga--gcttgctctct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9CA99_BCL2L11      cct---------g------------gggcccctacctccct---------
A0A2R9BZA9_BBC3-01      cct--------cg------------ctctcgctggcggagc---------
A0A2R8Z697_BAD-02       cccgcaggggacg------------ggccctcgggct--cc---------
A0A2R8Z697_BAD-03       cccgcaggggacg------------ggccctcgggct--cc---------
A0A2R8Z697_BAD-01       cccgcaggggacg------------ggccctcgggct--cc---------

A0A2R8ZXD2_BIK-01       gacgagatggacgtgagcctcagggcc--ccgc-----------------
A0A2R9AKC9_PMAIP1-      -----ag-------------caggaccggcgggtacggcgagggaccaag
A0A2R9AKC9_PMAIP1-      -----ag-------------cag---------------------------
A0A2R9BS98_BMF-02       -----gctgacctgtttgcccagagcctactgg-----------------
A0A2R9BS98_BMF-01       -----gctgacctgtttgcccagagcctactgg-----------------
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaag-----------------
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaag-----------------
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaag-----------------
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-aca-------------------
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2R9CA99_BCL2L11      -----acaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2R9BZA9_BBC3-01      -----agcacctggagtcgcccgtgcc--cagc-----------------
A0A2R8Z697_BAD-02       -----agcaagcatcatcgccaggccc--cagg-----------------
A0A2R8Z697_BAD-03       -----agcaagcatcatcgccaggccc--cagg-----------------
A0A2R8Z697_BAD-01       -----agcaagcatcatcgccaggccc--cagg-----------------
                                            * *                           

A0A2R8ZXD2_BIK-01       ---------gcctggcccagctctccgacgtggccatgcacagcctgggt
A0A2R9AKC9_PMAIP1-      ccggatttgggattgggatgcagctgcgtttcaccaggggcaaaaagctc
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       -------------------actgcccc-----------ctcagccgactt
A0A2R9BS98_BMF-01       -------------------actgcccc-----------ctcagccgactt
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      cacggaggtgaaggggacagctgcccc-----------cacggcagccct
A0A2R9CA99_BCL2L11      cacggaggtgaaggggacagctgcccc-----------cacggcagccct
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      cacggaggtgaaggggacagctgcccc-----------cacggcagccct
A0A2R9CA99_BCL2L11      cacggaggtgaaggggacagctgcccc-----------cacggcagccct
A0A2R9CA99_BCL2L11      cacggaggtgaaggggacagctgcccc-----------cacggcagccct
A0A2R9CA99_BCL2L11      cacggaggtgaaggggacagctgcccc-----------cacggcagccct
A0A2R9BZA9_BBC3-01      ----------------------gcccc-----------ggggg-------
A0A2R8Z697_BAD-02       ----------------------cctcc-----------tgtgggacgcca
A0A2R8Z697_BAD-03       ----------------------cctcc-----------tgtgggacgcca
A0A2R8Z697_BAD-01       ----------------------cctcc-----------tgtgggacgcca

A0A2R8ZXD2_BIK-01       ctggctttcatctacgaccagactgaggacatcagggatgttcttagaag
A0A2R9AKC9_PMAIP1-      ctttcctcctcttcctcctcgccacttgcccttccccggggccacgagga
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       cagctcttccctctcacccactgctgtggccctggccttc----------
A0A2R9BS98_BMF-01       cagctcttccctctcacccactgctgtggccctggccttc----------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      cag---ggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2R9CA99_BCL2L11      cag---ggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      cag---ggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2R9CA99_BCL2L11      cag---ggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2R9CA99_BCL2L11      cag---ggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2R9CA99_BCL2L11      cag---ggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2R9BZA9_BBC3-01      --ctctggcgggcggtcccacccaggcggccccgggagtccgcggggagg
A0A2R8Z697_BAD-02       gtcaccagcaggagcagccaaccag-------cagcagccatcatggaga
A0A2R8Z697_BAD-03       gtcaccagcaggagcagccaaccag-------cagcagccatcatggagg
A0A2R8Z697_BAD-01       gtcaccagcaggagcagccaaccag-------cagcagccatcatg----

A0A2R8ZXD2_BIK-01       t-------------------------------------------------
A0A2R9AKC9_PMAIP1-      acaagcg-------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2R9CA99_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2R9CA99_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2R9CA99_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2R9CA99_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2R9BZA9_BBC3-01      aggaac--------------------------------------------
A0A2R8Z697_BAD-02       agggacttcct---------------------------------------
A0A2R8Z697_BAD-03       gagaacttcgtattctccttcttgggaatctgaggactctgaaaatccca
A0A2R8Z697_BAD-01       --------------------------------------------------

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      ccagtgggtatttctctttt------------------------------
A0A2R9CA99_BCL2L11      ccagtgggtatttctctttt------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      ccagtgggtatttctctttt------------------------------
A0A2R9CA99_BCL2L11      ccagtgggtatttctctttt------------------------------
A0A2R9CA99_BCL2L11      ccagtgggtatttctctttt------------------------------
A0A2R9CA99_BCL2L11      ccagtgggtatttctctttt------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       gtgcagggatgctcgcggaagcatcagcagggatgtccgccccagccgct
A0A2R8Z697_BAD-01       --------------------------------------------------

A0A2R8ZXD2_BIK-01       --------------------------ttcatggacggtttcaccacactt
A0A2R9AKC9_PMAIP1-      --------------------------caagtagctggaagtcgagtgtgc
A0A2R9AKC9_PMAIP1-      -------------------------------agctggaagtcgagtgtgc
A0A2R9BS98_BMF-02       --------------------------------------gacccacca-gc
A0A2R9BS98_BMF-01       --------------------------------------gacccacca-gc
A0A2R9CA99_BCL2L11      ---------------------------------acaggagcccagca-cc
A0A2R9CA99_BCL2L11      ---------------------------------acaggagcccagca-cc
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------gacacagacaggagcccagca-cc
A0A2R9CA99_BCL2L11      --------------------------gacacagacaggagcccagca-cc
A0A2R9CA99_BCL2L11      -------------------------------agacaggagcccagca-cc
A0A2R9CA99_BCL2L11      --------------------------gacacagacaggagcccagca-cc
A0A2R9CA99_BCL2L11      --------------------------gacacagacaggagcccagca-cc
A0A2R9CA99_BCL2L11      --------------------------gacacagacaggagcccagca-cc
A0A2R9CA99_BCL2L11      --------------------------gacacagacaggagcccagca-cc
A0A2R9BZA9_BBC3-01      --------------------------agtgggcccgggagatcgggg-cc
A0A2R8Z697_BAD-02       ---------------cgcccgaagagcgcgggcacagcaacgcagat-gc
A0A2R8Z697_BAD-03       gactcagaagcccaacacgcagagaatgtaaagctagaggcgctggg-gc
A0A2R8Z697_BAD-01       ------------------------------------gaggcgctggg-gc

A0A2R8ZXD2_BIK-01       aaggagaacataatgaggttctggagatccccgaaccccaggtcctgggt
A0A2R9AKC9_PMAIP1-      tactcaactcaggagatttggagacaaactgaacttccg-----------
A0A2R9AKC9_PMAIP1-      tactcaactcaggagatttggagacaaactgaacttccg-----------
A0A2R9BS98_BMF-02       cagg-aa----gacaaagctacccagaccctcagcc-cagcct------c
A0A2R9BS98_BMF-01       cagg-aa----gacaaagctacccagaccctcagcc-cagcct------c
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9CA99_BCL2L11      catg-agttgtgacaaatcaacacaaaccccaagtc-ctccttgccaggc
A0A2R9BZA9_BBC3-01      c----agctgcggcggatggcggacgacctcaacgcgcagtacgagcggc
A0A2R8Z697_BAD-02       ggcaaagctccagctggacgcgagtcttccagtcctggtg---ggatcg-
A0A2R8Z697_BAD-03       tgtggagatccgg--agtcgccacagctcctaccccgcgg---ggacgga
A0A2R8Z697_BAD-01       tgtggagatccgg--agtcgccacagctcctaccccgcgg---ggacgga

A0A2R8ZXD2_BIK-01       gtcccgcgaacag-------------gtgctgctggcgctgctgctgctg
A0A2R9AKC9_PMAIP1-      ----------------------------gcagaaacttctgaatctgata
A0A2R9AKC9_PMAIP1-      ----------------------------gcagaaacttctgaatctgata
A0A2R9BS98_BMF-02       ccccagccaaggtgtcatgctgccttgtggggtgactg-------aggaa
A0A2R9BS98_BMF-01       ccccagccaaggtgtcatgctgccttgtggggtgactg-------aggaa
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatggtagtcatcctagagg
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatgg-----at------ga
A0A2R9CA99_BCL2L11      -----------------------------------cttccat------ga
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatggtt-------------
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaat-----------------
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatggcttccat------ga
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatggcttccat------ga
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatggcttccat------ga
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatggcttccat------ga
A0A2R9CA99_BCL2L11      cttcaaccactatctca---------gtgcaatggc--------------
A0A2R9BZA9_BBC3-01      ggaga--caagag-------------gagcagcagcggcaccgcccctcg
A0A2R8Z697_BAD-02       -------gaactt-------------gggcaggggaagctccgccccct-
A0A2R8Z697_BAD-03       ggacgacgaaggg-------------atgggggaggagcccagcccctt-
A0A2R8Z697_BAD-01       ggacgacgaaggg-------------atgggggaggagcccagcccctt-

A0A2R8ZXD2_BIK-01       ctggcgctgctgctgcc---------------------------------
A0A2R9AKC9_PMAIP1-      tccaaactcttc--------------------------------------
A0A2R9AKC9_PMAIP1-      tccaaactcttc--------------------------------------
A0A2R9BS98_BMF-02       ccccagcgactcttttatg-------------------------------
A0A2R9BS98_BMF-01       ccccagcgactcttttatggcaatgctggctatcggcttcctctccctgc
A0A2R9CA99_BCL2L11      atataggtgatctttcact-------------------------------
A0A2R9CA99_BCL2L11      ctccgctggatcct------------------------------------
A0A2R9CA99_BCL2L11      ggcaggctgaacctgcaga-------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      ggcaggctgaacctgcaga-------------------------------
A0A2R9CA99_BCL2L11      ggcaggctgaacctgcaga-------------------------------
A0A2R9CA99_BCL2L11      ggcaggctgaacctgcaga-------------------------------
A0A2R9CA99_BCL2L11      ggcaggctgaacctgcaga-------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      ccctggagggtcctgtaca-------------------------------
A0A2R8Z697_BAD-02       cc-cagtgactttcgctcc-------------------------------
A0A2R8Z697_BAD-03       tcggggccgctcgcgctcg-------------------------------
A0A2R8Z697_BAD-01       tcggggccgctcgcgctcg-------------------------------

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-01       cagtttcccagcagtcttgcccattggggagcagccccccgaagggcagt
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      -------------------------tgctcaggaac--------------
A0A2R9AKC9_PMAIP1-      -------------------------tgctcaggaac--------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-01       ggcaacatcgagcagaggtacagattgcccgaaagcttcagtg----cat
A0A2R9CA99_BCL2L11      ----gtgctttggatttatatttactggcttagatttgtatggccaccac
A0A2R9CA99_BCL2L11      --------------------------ccctcagaattgccctt----cat
A0A2R9CA99_BCL2L11      ----tatgcgcccggagatatggatcgcccaagagttgcggcg----tat
A0A2R9CA99_BCL2L11      -------------agagaaataga------ggaagttgtcgtg----tag
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      ----tatgcgcccggagatatggatcgcccaagagttgcggcg----tat
A0A2R9CA99_BCL2L11      ----tatgcgcccggagatatggatcgcccaagagttgcggcg----tat
A0A2R9CA99_BCL2L11      ----tatgcgcccggagatatggatcgcccaagagttgcggcg----tat
A0A2R9CA99_BCL2L11      ----tatgcgcccggagatatggatcgcccaagagttgcggcg----tat
A0A2R9CA99_BCL2L11      -----------------------------------------------taa
A0A2R9BZA9_BBC3-01      ---------------------atctcatcatgggactcctgcc-------
A0A2R8Z697_BAD-02       ---------------------a---catcccgaaactccaccc-------
A0A2R8Z697_BAD-03       ---------------------g---cgccccccaac--------------
A0A2R8Z697_BAD-01       ---------------------g---cgccccccaac--------------

A0A2R8ZXD2_BIK-01       ------------------------------------gctgctcagcgggg
A0A2R9AKC9_PMAIP1-      ------------------------------------ctgactgcatcaaa
A0A2R9AKC9_PMAIP1-      ------------------------------------ctga----------
A0A2R9BS98_BMF-02       ----------------------------------caccagcagaaccaaa
A0A2R9BS98_BMF-01       tgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaa
A0A2R9CA99_BCL2L11      catagtcaagatgca-------------------gaacaactcaaccaca
A0A2R9CA99_BCL2L11      aggga---agttcag-------------------tggccact----caag
A0A2R9CA99_BCL2L11      cggagacgagtttaa-------------------cgcttactatgcaagg
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      cggagacgagtttaa-------------------cgcttactatgcaagg
A0A2R9CA99_BCL2L11      cggagacgagtttaa-------------------cgcttactatgcaagg
A0A2R9CA99_BCL2L11      cggagacgagtttaa-------------------cgcttactatgcaagg
A0A2R9CA99_BCL2L11      cggagacgagtttaa-------------------cgcttactatgcaagg
A0A2R9CA99_BCL2L11      ctgggactag----------------------------------------
A0A2R9BZA9_BBC3-01      --------------------cttac-----ccaggggccacagagc----
A0A2R8Z697_BAD-02       --------------------gttcccactgccctgggcagc-catcttga
A0A2R8Z697_BAD-03       ------------------------------ctctgggcagcacagc---g
A0A2R8Z697_BAD-01       ------------------------------ctctgggcagcacagc---g

A0A2R8ZXD2_BIK-01       g------------------cctgcacctgctgctcaagtga---------
A0A2R9AKC9_PMAIP1-      aacttgcatgaggggactccttcaaaagagttttctcaggaggtgcacgt
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       atcgtgtgtggtggcagatcctcctcttcctgcacaaccttgctttgaat
A0A2R9BS98_BMF-01       atcgtgtgtggtggcagatcctcctcttcctgcacaaccttgctttgaat
A0A2R9CA99_BCL2L11      a-------ggat----------------ttctcatga-------------
A0A2R9CA99_BCL2L11      t-------ggttagcaaaatca---------agctaa-------------
A0A2R9CA99_BCL2L11      a-------ggctggcaaaactcctgtcctccacctga-------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------gggt------attttt-------gaataa-------------
A0A2R9CA99_BCL2L11      a-------gggt------attttt-------gaataattaccaagcagcc
A0A2R9CA99_BCL2L11      a-------gggt------attttt-------gaataattaccaagcagcc
A0A2R9CA99_BCL2L11      a-------ggat------gcctcttccacctgattaa-------------
A0A2R9CA99_BCL2L11      a-------ggtt---------------agagaaatag-------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      -------------------ccccgagatggagcccaattag---------
A0A2R8Z697_BAD-02       atatgggcggaagtacttccctcaggcctatgcaaaaagaggatccgtgc
A0A2R8Z697_BAD-03       ctatggccgcgag-------ctccggaggatga-----------------
A0A2R8Z697_BAD-01       ctatggccgcgag-------ctccggaggatgagtgacgagtttgtggac

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      ttcatcaatttgaagaaagactgcattgtaattgg---------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       ggagaagagaacaggaacggggcaggccctag------------------
A0A2R9BS98_BMF-01       ggagaagagaacaggaacggggcaggccctaggtga--------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      gaagaccacccacgaatggttatcttacgactgttacgttacattgtccg
A0A2R9CA99_BCL2L11      gaagaccacccacgaatggttatcttacgactgttacgttacattgtccg
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z697_BAD-02       t------------gtctcctttggagggagggc----------tgaccca
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-01       tcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgca

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      cctggtgtggagaatgcattga----------------------------
A0A2R9CA99_BCL2L11      cctggtgtggagaatgcattga----------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z697_BAD-02       gattc------------------------ccttccggtgcgtgtga----
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-01       gatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatc

A0A2R8ZXD2_BIK-01       --------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------
A0A2R8Z697_BAD-01       ggaacttgggcaggggaagctccgccccctcccagtga

© 1998-2019