Dataset for CDS classical BH3-containing proteins of organism Ovis aries

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5P8G9_BAD-01          ------caggggcctcgttatcgggcttgggcccagagcatgttccagat
W5QCU2_BIK-01          atgtatcaagca----------------------agacccctctctagga
W5QFV1_BMF-01          --ctcacagggg----------------------aga------tggagcc
W5P738_PMAIP1-01       at------------------------------------------------
W5PY58_BCL2L11-01      atggcaaagcaa--------------------------ccttccgatgta
                                                                         

W5P8G9_BAD-01          cccagagtttgagcagagtgagcaggaagac----tccagccctgcagat
W5QCU2_BIK-01          acctctttttgt-----------------acaccttcctacaa-------
W5QFV1_BMF-01          accccagtgtgtggaggagctggaggatgacgtattccagccagaggatg
W5P738_PMAIP1-01       -----------------------------------gcctggaaggagggc
W5PY58_BCL2L11-01      agttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcc
                                                           **            

W5P8G9_BAD-01          ---------------aggggcctgggccccagccccacaggggacaggcc
W5QCU2_BIK-01          ------------------aacca------cggccc----aggc-----tt
W5QFV1_BMF-01          ---------------gggagccaggggcccagccc----aggaggttgct
W5P738_PMAIP1-01       tcgt-----------aggagcg-----cccagc-----------------
W5PY58_BCL2L11-01      tcctcagctcagaccaggggcc-----cccacctctttacagacagagcg
                                           *        *  *                 

W5P8G9_BAD-01          cccaggtctc-----agcaagcactggctaacagccccgggcctcctggg
W5QCU2_BIK-01          cctggatgac-----------------caa--ggctcagggcttcccggc
W5QFV1_BMF-01          ctctgctgac-----------------ctgtttgcccagagccagctgga
W5P738_PMAIP1-01       --------------------------------------------------
W5PY58_BCL2L11-01      gcaaggtaatcctgaaggagaaggggaccgctgcccccaaggcagcccgc
                                                                         

W5P8G9_BAD-01          ggaagc---tggtcacca--gcaggggcagccggccggcagcagccacca
W5QCU2_BIK-01          gtgac----cagtatctt--ggagttccaccc------catctcccccta
W5QFV1_BMF-01          ctgccccctcagccgtct--gcagctcttccc------tctcacgcactg
W5P738_PMAIP1-01       --------cgagccccac--gcgggtcccggc------------------
W5PY58_BCL2L11-01      agggcccgctggccccaccggccagccccggc--------cctttcgcta
                                  *        *          *                  

W5P8G9_BAD-01          tggaggcactggg---------------------------gctgtggaga
W5QCU2_BIK-01          cagtgac--------------------------agtccacactacctggc
W5QFV1_BMF-01          ctgtggccctgggcttcgacccaccagccaggaagacaaggctacccaga
W5P738_PMAIP1-01       -----------------------------agatcct--------------
W5PY58_BCL2L11-01      ccagatccccgctcttcatcttcgtgagaagatcctccttgctgtctcgg
                                                                         

W5P8G9_BAD-01          cccggagtcgtcacagctcctacccc-------gcggggccagaggatga
W5QCU2_BIK-01          catgcag-c----tggcctccattgccgacgagatggagctgaggt----
W5QFV1_BMF-01          ctctcagcc----cagcttcccc-------------gagccagggtgtca
W5P738_PMAIP1-01       --------------------------------------------------
W5PY58_BCL2L11-01      tcctccagcgg--gtatttctcttttgacacagacaggagcccggcaccc
                                                                         

W5P8G9_BAD-01          cgaagggac----ggaggaggaggatctc----ggcccctttagggg-cc
W5QCU2_BIK-01          tgctgctgccccagttcgttgagcccttctggatgcccatgtacagc---
W5QFV1_BMF-01          tgctgccttgtggggtgactgaggagccccagcgactcttttatggcaat
W5P738_PMAIP1-01       -gaagttgag----------------------------------------
W5PY58_BCL2L11-01      atgagttgtgacaaatccacacagaccccaagccctccttgccaggc---
                           *                                             

W5P8G9_BAD-01          gctcgcgttcggcgccccccaac------------ctctgggctgcac--
W5QCU2_BIK-01          --------ttgtgtttcccctacagccacgtagggctcagggatgttc--
W5QFV1_BMF-01          gctggctaccggctcccccttcctgccagtttccctgcaggcttgcccct
W5P738_PMAIP1-01       --------------------------------------------------
W5PY58_BCL2L11-01      ----------------cttcaaccattatctcagtgcaatggcttcca--
                                                                         

W5P8G9_BAD-01          --------agcgatatggccgcgagctccga-----aggatgagcgacga
W5QCU2_BIK-01          ---tgagaagctttatggttgctttcaccaacct-cagggagaa------
W5QFV1_BMF-01          tggtgagcaaccccctgaagggcagtggcaacat-cgagcagagatacag
W5P738_PMAIP1-01       ---tgtgccattc-------------------------------------
W5PY58_BCL2L11-01      ---tgaggcagtctcaggctgtacctgcagatacacgcccagagatatgg
                                                                         

W5P8G9_BAD-01          gtttcacgtctccttcaaggggctt------cctcgcccga---------
W5QCU2_BIK-01          -----ccgaaggctct--ggagctt------cctgactctc---------
W5QFV1_BMF-01          attgcccgaaaactcc--agtgcattgcagaccagttccat---------
W5P738_PMAIP1-01       ----------agttga--ggagaattggagacaaactgaat--------t
W5PY58_BCL2L11-01      attgctcaagagctac--ggcgtatcggagacgagtttaatgcgtattat
                                    *     * *  *      *                  

W5P8G9_BAD-01          --------agagcgcgggcacggcaacgcaaat----gcgacaaagccct
W5QCU2_BIK-01          --------agggaccgggtgtcgc----ccagc----ctg---tggcccg
W5QFV1_BMF-01          --------cggcttcatatgcagcaacaccagcagaaccgaaatcgcatg
W5P738_PMAIP1-01       tccggcagaaactt-gtgaatc----------t--------gatagc---
W5PY58_BCL2L11-01      ccaagaagggtcttcgtgcgtcaccaggcgatt--------gagggccac
                                                                    **   

W5P8G9_BAD-01          agctggacg------cgcttcctcca-gtcctggttgagccggaacttgg
W5QCU2_BIK-01          agctggca-------ctgtccctgctggtggtggcgatgctc--agctgg
W5QFV1_BMF-01          tggtggcagatcctcctcttcctacacaacgtggctttgaatggagatga
W5P738_PMAIP1-01       ---caaa-----------ctcctccgc-tcaggaact-------------
W5PY58_BCL2L11-01      ccacaaatg------gtcctcctgcgcgtcttgcgctacctggtgcgtct
                                           *** *       *                 

W5P8G9_BAD-01          ggagagga--ggctccgccccctctcagtga
W5QCU2_BIK-01          g---------ggtgccgcttc----------
W5QFV1_BMF-01          gaacaggaatggggcaggcccc---aggtga
W5P738_PMAIP1-01       ----------------------------tga
W5PY58_BCL2L11-01      ggtgtggaggatg------------cagtga
                                                      

© 1998-2018