Dataset for CDS classical BH3-containing proteins of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3HDU2_BAD-01      atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggt
A0A3B3I0V9_BMF-03      atgg---------------------acgat------------gaggaaga
A0A3B3I0V9_BMF-01      atgg---------------------acgat------------gaggaaga
A0A3B3I0V9_BMF-02      atgg---------------------acgat------------gaggaaga
A0A3P9JM16_BMF-03      atgg---------------------acgat------------gaggaaga
A0A3P9JM16_BMF-02      atgg---------------------acgat------------gaggaaga
A0A3P9JM16_BMF-01      atgg---------------------acgat------------gaggaaga
A0A3B3I0V9_BMF-04      atgg---------------------acgat------------gaggaaga
                       ****                     *****            ***** * 

A0A3B3HDU2_BAD-01      agagggaggaaaacttgacct---------gggagcggcag-caggagga
A0A3B3I0V9_BMF-03      cgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaaga
A0A3B3I0V9_BMF-01      cgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaaga
A0A3B3I0V9_BMF-02      cgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaaga
A0A3P9JM16_BMF-03      cgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaaga
A0A3P9JM16_BMF-02      cgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaaga
A0A3P9JM16_BMF-01      cgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaaga
A0A3B3I0V9_BMF-04      cgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaaga
                        ** *      * *  ****          * *  ** *** ***** **

A0A3B3HDU2_BAD-01      gaagg----------ggagcaccttcatgatcgacattc--cctcaccct
A0A3B3I0V9_BMF-03      taaagtgtgaagaccggggcac-------gcagacacccggtcctgccct
A0A3B3I0V9_BMF-01      taaagtgtgaagaccggggcac-------gcagacacccggtcctgccct
A0A3B3I0V9_BMF-02      taaagtgtgaagaccggggcac-------gcagacacccggtcctgccct
A0A3P9JM16_BMF-03      taaagtgtgaagaccggggcac-------gcagacacccggtcctgccct
A0A3P9JM16_BMF-02      taaagtgtgaagaccggggcac-------gcagacacccggtcctgccct
A0A3P9JM16_BMF-01      taaagtgtgaagaccggggcac-------gcagacacccggtcctgccct
A0A3B3I0V9_BMF-04      taaagtgtgaagaccggggcac-------gcagacacccggtcctgccct
                        ** *          ** ****          ****  *   *   ****

A0A3B3HDU2_BAD-01      g---ccaga---------gcttc------gactcaca-------------
A0A3B3I0V9_BMF-03      ggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
A0A3B3I0V9_BMF-01      ggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
A0A3B3I0V9_BMF-02      ggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
A0A3P9JM16_BMF-03      ggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
A0A3P9JM16_BMF-02      ggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
A0A3P9JM16_BMF-01      ggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
A0A3B3I0V9_BMF-04      ggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
                       *   *** *         *****      ****  **             

A0A3B3HDU2_BAD-01      -----------agtaacgggcgtaccaggctg-aattcagagtccacc--
A0A3B3I0V9_BMF-03      cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttt
A0A3B3I0V9_BMF-01      cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttt
A0A3B3I0V9_BMF-02      cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttt
A0A3P9JM16_BMF-03      cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttt
A0A3P9JM16_BMF-02      cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttt
A0A3P9JM16_BMF-01      cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttt
A0A3B3I0V9_BMF-04      cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttt
                                   ******   **    *  ** * ***  **  * *   

A0A3B3HDU2_BAD-01      --gcttccacgtactccagagatgaggacctcgcgcgggaagacgaggc-
A0A3B3I0V9_BMF-03      gagcttgctggggatcttgaggtgag--------gcggcacgacagggaa
A0A3B3I0V9_BMF-01      gagcttgctggggatcttgaggtgag--------gcggcacgacagggaa
A0A3B3I0V9_BMF-02      gagcttgctggggatcttgaggtgag--------gcggcacgacagggaa
A0A3P9JM16_BMF-03      gagcttgctggggatcttgaggtgag--------gcggcacgacagggaa
A0A3P9JM16_BMF-02      gagcttgctggggatcttgaggtgag--------gcggcacgacagggaa
A0A3P9JM16_BMF-01      gagcttgctggggatcttgaggtgag--------gcggcacgacagggaa
A0A3B3I0V9_BMF-04      gagcttgctggggatcttgaggtgag--------gcggcacgacagggaa
                         **** *  *   **  *** ****        **** * ***  **  

A0A3B3HDU2_BAD-01      -cggaacccccactgatgggttggccttcaggggcagatccaagtcggcc
A0A3B3I0V9_BMF-03      gcagagc-----------------------ggcgcgggatggag-cggct
A0A3B3I0V9_BMF-01      gcagagc-----------------------ggcgcgggatggag-cggct
A0A3B3I0V9_BMF-02      gcagagc-----------------------ggcgcgggatggag-cggct
A0A3P9JM16_BMF-03      gcagagc-----------------------ggcgcgggatggag-cggct
A0A3P9JM16_BMF-02      gcagagc-----------------------ggcgcgggatggag-cggct
A0A3P9JM16_BMF-01      gcagagc-----------------------ggcgcgggatggag-cggct
A0A3B3I0V9_BMF-04      gcagagc-----------------------ggcgcgggatggag-cggct
                        * ** *                       ** ** *     ** **** 

A0A3B3HDU2_BAD-01      cctccggc-----tctgtgggccgccaaaaagtacgg-------------
A0A3B3I0V9_BMF-03      tccccggcagcagcctgtggcacgc-----agcacggaggcctgcattgc
A0A3B3I0V9_BMF-01      tccccggcagcagcctgtggcacgc-----agcacggaggcctgcattgc
A0A3B3I0V9_BMF-02      tccccggcagcagcctgtggcacgc-----agcacggaggcctgcattgc
A0A3P9JM16_BMF-03      tccccggcagcagcctgtggcacgc-----agcacggaggcctgcattgc
A0A3P9JM16_BMF-02      tccccggcagcagcctgtggcacgc-----agcacggaggcctgcattgc
A0A3P9JM16_BMF-01      tccccggcagcagcctgtggcacgc-----agcacggaggcctgcattgc
A0A3B3I0V9_BMF-04      tccccggcagcagcctgtggcacgc-----agcacggaggcctgcattgc
                        * *****      ******  ***     ** ****             

A0A3B3HDU2_BAD-01      tcagcagctccgacggatgagcgacgagttt------gacagcct---gc
A0A3B3I0V9_BMF-03      acagaaactccagctgataggggaccagtttcaccgggaacgcctacaac
A0A3B3I0V9_BMF-01      acagaaactccagctgataggggaccagtttcaccgggaacgcctacaac
A0A3B3I0V9_BMF-02      acagaaactccagctgataggggaccagtttcaccgggaacgcctacaac
A0A3P9JM16_BMF-03      acagaaactccagctgataggggaccagtttcaccgggaacgcctacaac
A0A3P9JM16_BMF-02      acagaaactccagctgataggggaccagtttcaccgggaacgcctacaac
A0A3P9JM16_BMF-01      acagaaactccagctgataggggaccagtttcaccgggaacgcctacaac
A0A3B3I0V9_BMF-04      acagaaactccagctgataggggaccagtttcaccgggaacgcctacaac
                        *** * ****  * ***  * *** *****      **  ****    *

A0A3B3HDU2_BAD-01      tggataaaggggagatgaggaaggtgaggagcactggggcggccaaacag
A0A3B3I0V9_BMF-03      tgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-------
A0A3B3I0V9_BMF-01      tgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-------
A0A3B3I0V9_BMF-02      tgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-------
A0A3P9JM16_BMF-03      tgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-------
A0A3P9JM16_BMF-02      tgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-------
A0A3P9JM16_BMF-01      tgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-------
A0A3B3I0V9_BMF-04      tgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-------
                       ** ** *  *  *    *****   * **    * ** * **        

A0A3B3HDU2_BAD-01      atgctccactccacgagctggtggaactacctcttcagccacccggaggc
A0A3B3I0V9_BMF-03      -ggcgcctcgccacg-gct-----------ctcgtcagccttct--attc
A0A3B3I0V9_BMF-01      -ggcgcctcgccacg-gct-----------ctcgtcagccttct--attc
A0A3B3I0V9_BMF-02      -ggcgcctcgccacg-gct-----------ctcgtcagccttct--attc
A0A3P9JM16_BMF-03      -ggcgcctcgccacg-gct-----------ctcgtcagccttct--attc
A0A3P9JM16_BMF-02      -ggcgcctcgccacg-gct-----------ctcgtcagccttct--attc
A0A3P9JM16_BMF-01      -ggcgcctcgccacg-gct-----------ctcgtcagccttct--attc
A0A3B3I0V9_BMF-04      -ggcgcctcgccacg-gct-----------ctcgtcagccttct--attc
                         ** ** * ***** ***           *** ******  *   *  *

A0A3B3HDU2_BAD-01      ggaaggaga-gtacagccaccacgagagccaccgcactga-gtaa-----
A0A3B3I0V9_BMF-03      gatagaggctttattgctggagcagggggtgcaggacaaaggtaa-----
A0A3B3I0V9_BMF-01      gatagaggctttattgctggagcagggggtgcaggacaaaggtaa-----
A0A3B3I0V9_BMF-02      gatagaggctttattgctggagcagggggtgcaggacaaaggtaa-----
A0A3P9JM16_BMF-03      gatagaggctttattgctggagcagggggtgcaggacaaaggtaa-----
A0A3P9JM16_BMF-02      gatagaggctttattgctggagcagggggtgcaggacaaaggtaa-----
A0A3P9JM16_BMF-01      gatagaggctttattgctggagcagggggtgcaggacaaaggtaa-----
A0A3B3I0V9_BMF-04      gatagaggctttattgctggagcagggggtgcaggacaaaggcaatctgt
                       *  **  *   **  **     *  * *   * * **  * * **     

A0A3B3HDU2_BAD-01      -------------
A0A3B3I0V9_BMF-03      -------------
A0A3B3I0V9_BMF-01      -------------
A0A3B3I0V9_BMF-02      -------------
A0A3P9JM16_BMF-03      -------------
A0A3P9JM16_BMF-02      -------------
A0A3P9JM16_BMF-01      -------------
A0A3B3I0V9_BMF-04      cgtgagtgactga
                                    

© 1998-2019