Dataset for CDS BMF of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3I0V9_BMF-03      atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcg
A0A3B3I0V9_BMF-01      atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcg
A0A3B3I0V9_BMF-02      atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcg
A0A3P9JM16_BMF-03      atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcg
A0A3P9JM16_BMF-02      atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcg
A0A3P9JM16_BMF-01      atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcg
A0A3B3I0V9_BMF-04      atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcg
                       **************************************************

A0A3B3I0V9_BMF-03      cacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccg
A0A3B3I0V9_BMF-01      cacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccg
A0A3B3I0V9_BMF-02      cacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccg
A0A3P9JM16_BMF-03      cacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccg
A0A3P9JM16_BMF-02      cacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccg
A0A3P9JM16_BMF-01      cacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccg
A0A3B3I0V9_BMF-04      cacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccg
                       **************************************************

A0A3B3I0V9_BMF-03      gtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagag
A0A3B3I0V9_BMF-01      gtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagag
A0A3B3I0V9_BMF-02      gtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagag
A0A3P9JM16_BMF-03      gtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagag
A0A3P9JM16_BMF-02      gtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagag
A0A3P9JM16_BMF-01      gtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagag
A0A3B3I0V9_BMF-04      gtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagag
                       **************************************************

A0A3B3I0V9_BMF-03      gagcccagaccacttttctacggtaacgcaggttttcgattgcacttccc
A0A3B3I0V9_BMF-01      gagcccagaccacttttctacggtaacgcaggttttcgattgcacttccc
A0A3B3I0V9_BMF-02      gagcccagaccacttttctacggtaacgcaggttttcgattgcacttccc
A0A3P9JM16_BMF-03      gagcccagaccacttttctacggtaacgcaggttttcgattgcacttccc
A0A3P9JM16_BMF-02      gagcccagaccacttttctacggtaacgcaggttttcgattgcacttccc
A0A3P9JM16_BMF-01      gagcccagaccacttttctacggtaacgcaggttttcgattgcacttccc
A0A3B3I0V9_BMF-04      gagcccagaccacttttctacggtaacgcaggttttcgattgcacttccc
                       **************************************************

A0A3B3I0V9_BMF-03      agcacgctttgagcttgctggggatcttgaggtgaggcggcacgacaggg
A0A3B3I0V9_BMF-01      agcacgctttgagcttgctggggatcttgaggtgaggcggcacgacaggg
A0A3B3I0V9_BMF-02      agcacgctttgagcttgctggggatcttgaggtgaggcggcacgacaggg
A0A3P9JM16_BMF-03      agcacgctttgagcttgctggggatcttgaggtgaggcggcacgacaggg
A0A3P9JM16_BMF-02      agcacgctttgagcttgctggggatcttgaggtgaggcggcacgacaggg
A0A3P9JM16_BMF-01      agcacgctttgagcttgctggggatcttgaggtgaggcggcacgacaggg
A0A3B3I0V9_BMF-04      agcacgctttgagcttgctggggatcttgaggtgaggcggcacgacaggg
                       **************************************************

A0A3B3I0V9_BMF-03      aagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggca
A0A3B3I0V9_BMF-01      aagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggca
A0A3B3I0V9_BMF-02      aagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggca
A0A3P9JM16_BMF-03      aagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggca
A0A3P9JM16_BMF-02      aagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggca
A0A3P9JM16_BMF-01      aagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggca
A0A3B3I0V9_BMF-04      aagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggca
                       **************************************************

A0A3B3I0V9_BMF-03      cgcagcacggaggcctgcattgcacagaaactccagctgataggggacca
A0A3B3I0V9_BMF-01      cgcagcacggaggcctgcattgcacagaaactccagctgataggggacca
A0A3B3I0V9_BMF-02      cgcagcacggaggcctgcattgcacagaaactccagctgataggggacca
A0A3P9JM16_BMF-03      cgcagcacggaggcctgcattgcacagaaactccagctgataggggacca
A0A3P9JM16_BMF-02      cgcagcacggaggcctgcattgcacagaaactccagctgataggggacca
A0A3P9JM16_BMF-01      cgcagcacggaggcctgcattgcacagaaactccagctgataggggacca
A0A3B3I0V9_BMF-04      cgcagcacggaggcctgcattgcacagaaactccagctgataggggacca
                       **************************************************

A0A3B3I0V9_BMF-03      gtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
A0A3B3I0V9_BMF-01      gtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
A0A3B3I0V9_BMF-02      gtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
A0A3P9JM16_BMF-03      gtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
A0A3P9JM16_BMF-02      gtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
A0A3P9JM16_BMF-01      gtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
A0A3B3I0V9_BMF-04      gtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
                       **************************************************

A0A3B3I0V9_BMF-03      ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgat
A0A3B3I0V9_BMF-01      ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgat
A0A3B3I0V9_BMF-02      ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgat
A0A3P9JM16_BMF-03      ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgat
A0A3P9JM16_BMF-02      ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgat
A0A3P9JM16_BMF-01      ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgat
A0A3B3I0V9_BMF-04      ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgat
                       **************************************************

A0A3B3I0V9_BMF-03      agaggctttattgctggagcagggggtgcaggacaaaggtaa--------
A0A3B3I0V9_BMF-01      agaggctttattgctggagcagggggtgcaggacaaaggtaa--------
A0A3B3I0V9_BMF-02      agaggctttattgctggagcagggggtgcaggacaaaggtaa--------
A0A3P9JM16_BMF-03      agaggctttattgctggagcagggggtgcaggacaaaggtaa--------
A0A3P9JM16_BMF-02      agaggctttattgctggagcagggggtgcaggacaaaggtaa--------
A0A3P9JM16_BMF-01      agaggctttattgctggagcagggggtgcaggacaaaggtaa--------
A0A3B3I0V9_BMF-04      agaggctttattgctggagcagggggtgcaggacaaaggcaatctgtcgt
                       *************************************** **        

A0A3B3I0V9_BMF-03      ----------
A0A3B3I0V9_BMF-01      ----------
A0A3B3I0V9_BMF-02      ----------
A0A3P9JM16_BMF-03      ----------
A0A3P9JM16_BMF-02      ----------
A0A3P9JM16_BMF-01      ----------
A0A3B3I0V9_BMF-04      gagtgactga
                                 

© 1998-2019