Dataset for CDS classical BH3-containing proteins of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1SS60_BAD-01          --------------------------------------ccgcgcccca--
G1SR62_BMF-01          atggagccacctcagt---------gtgtggag---gagctgg----agg
G1TZR9_BIK-01          --------------at---------gtctgaagtcagacctggctccagg
G1SSY0_BCL2L11-01      atggccaagcaaccttccgatgtaagttctgagtgtgacagag----aag
G1T7W1_HRK-01          --------------------------------atgtgcccg---------

G1SS60_BAD-01          --aacccctctccgcaggcgccggagctatg-------------gaaacc
G1SR62_BMF-01          atgacgtgttccagccagaggacggggagcc------ggggacccagccc
G1TZR9_BIK-01          --gacctcttcca-----------ggaagccctcctggatgagcaggtcc
G1SSY0_BCL2L11-01      gtggacagttgcagcctgcggagaggccgcc-------ccagctcaggcc
G1T7W1_HRK-01          ---------tgccccctgcaccgtggccgc--------------------
                                  *             *                        

G1SS60_BAD-01          cggagccgccacagct--------------------------------cg
G1SR62_BMF-01          caaagcttgctctctgctgac-ccgtttgcccagagccagctggac--tg
G1TZR9_BIK-01          cagaac-----ctctgttgacggcggaagttcccggc---ctgacc--cg
G1SSY0_BCL2L11-01      tggggcccccacctccctgcagtcggagccgcaaggtaatccggaaggcg
G1T7W1_HRK-01          ---ggccccc--------------------------------------cg
                            *                                           *

G1SS60_BAD-01          taccctgcggacgcgg-------------------------------acg
G1SR62_BMF-01          ccccctggggcggctgcacctcttccctctcacccactgct---------
G1TZR9_BIK-01          tcccgtggaggaagggga---cttggatctcatggagtgcctcgagggca
G1SSY0_BCL2L11-01      accgctgtgcgcacggcagccctcagggcccgctggccccatcggccagc
G1T7W1_HRK-01          gccg-tgtgcgc-ctgcagcgc---gggccgcctgg-------ggctgcg
                         *  **        *                                  

G1SS60_BAD-01          acagcgaaggggccgaggaggagcccagcccctttcgggg----------
G1SR62_BMF-01          --------gtggtcctg-ggctgcgacccaccagccaggaagacaaggcc
G1TZR9_BIK-01          gtaaccaggtggccctgaggctggcgtacatcggc---gacgagatgg--
G1SSY0_BCL2L11-01      cc-------tggccctttcgctaccaggtccccgctcttcatctttgt--
G1T7W1_HRK-01          ct-------cggccgccgcgcag---------------------------
                                 ** *     *                              

G1SS60_BAD-01          ccgctcgcgctcggcgccccccaacctctgg-------------gctgca
G1SR62_BMF-01          acccagaccctcagccccgcc---tccccgagccaaggggtcatgctgcc
G1TZR9_BIK-01          acctgcacgtccggggcctcc---acactggccca---------gctgcc
G1SSY0_BCL2L11-01      ccgaagatcctccctgctgtc---tcgatcgtccagtgggtatttct--c
G1T7W1_HRK-01          ---------ctcaccgccgcc---cggctca-------------------
                                  *    *   *                             

G1SS60_BAD-01          cagcgctacggccgcgagctccgaagg-atgagcgacg------------
G1SR62_BMF-01          ttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggct
G1TZR9_BIK-01          ----ggggtggccatgcacagcttggccttcacctacagccagacgggct
G1SSY0_BCL2L11-01      ttttgacacagacaggagcccggcacccatgagctgtgacaaatcaa--c
G1T7W1_HRK-01          -------------aggcactcggcg---acgagctgca------------

G1SS60_BAD-01          -------------------------------------------agttcga
G1SR62_BMF-01          accggctccctctccctgccagtttccctgcaaacttcgcgctgggggag
G1TZR9_BIK-01          tc---------------acgggtgttctcggaagcgtggggct-------
G1SSY0_BCL2L11-01      acaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaa
G1T7W1_HRK-01          -----------------------------------------ccagcgca-

G1SS60_BAD-01          gggctccgtcaaga--agggactgcct-------------------cgc-
G1SR62_BMF-01          cagccccctgaagggcagtggcagcat---------------------cg
G1TZR9_BIK-01          ---ccacct---------tgccagcct---------------------c-
G1SSY0_BCL2L11-01      tggcttcca-------tgaggcagtctcaggctgaacctgcagacacgcg
G1T7W1_HRK-01          ------cca-------tgtggcggcgc-------------------cgcg
                             *            * * *                        * 

G1SS60_BAD-01          ---------ccgaagagcgcgggcacagcgatgcagatgagggaaagctc
G1SR62_BMF-01          agcagaggtccagattgctcggaagcttcagtgcattgctga-ccagttc
G1TZR9_BIK-01          -gtagagctctggagcccctggggg---cggggggctgctgctcctgctg
G1SSY0_BCL2L11-01      tccggagacctggatcgcgcaggagttgcggcggatcggaga-cgagttc
G1T7W1_HRK-01          cgcggag--ccggagggcgccggcgcc------------cgg-cgcgctc
                                *   *   *   *                  *     * * 

G1SS60_BAD-01          cagctggacgcgcgtcat------------------------ccagtctt
G1SR62_BMF-01          cacc--ggcttcattt--------------------------acagcaac
G1TZR9_BIK-01          cagtgaggcccctccc--------------------------agggcagg
G1SSY0_BCL2L11-01      aacgcgtattacccacgcagggtttttttgaataattacccagcagcgga
G1T7W1_HRK-01          cccacctactggccctggctg---------------tgcgcggccgcgca

G1SS60_BAD-01          ggtgggatcgcaatttggggaaagga----ggctccgccccttcccag--
G1SR62_BMF-01          accagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcctgcac
G1TZR9_BIK-01          gctggc--ccccgtcctggcgtgtgg-------tcctccttggggcgggc
G1SSY0_BCL2L11-01      gg-agcagccccaaatggttatcttg---------cgactgttgcgttac
G1T7W1_HRK-01          ggtggcggcgc----tggcggcctgg---------ctgct----------
                           *     *                        *  *           

G1SS60_BAD-01          --------------------------------------------------
G1SR62_BMF-01          aacctggctctgaatggtgacgagaacagggatggggcaggtcctaggtg
G1TZR9_BIK-01          agctggggcct-------------------------gcggatgcca----
G1SSY0_BCL2L11-01      atcgtgcgcct-------------------ggtgtggaggatgcat----
G1T7W1_HRK-01          ------cggca-------------------g--gcggaacttg-------

G1SS60_BAD-01          -
G1SR62_BMF-01          a
G1TZR9_BIK-01          -
G1SSY0_BCL2L11-01      -
G1T7W1_HRK-01          -

© 1998-2019