Dataset for CDS classical BH3-containing proteins of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3K2D6_BMF-01      atg---------------------gacgatgaggagga------cgatgtgtttgagcca
I3K7B6_BAD-01      atggctgcaaacttcacaatttcagacagtgaatcggagacatcagaggaggtaggggaa
                   ***                     ***  ***   ***       ** * * * * *  *

I3K2D6_BMF-01      aaagccaactgttggcgcaccacattcagggagataaagtgtgaacatcgaggcacacag
I3K7B6_BAD-01      gaagaaaac----------caacagccagcaggacaagatcaagaaagcaag--ccccag
                    ***  ***          * ***  ***   ** **  *    * * * **   * ***

I3K2D6_BMF-01      acacccggtcctgccctggtaccaaacaacggcatg--ctgccctgtggagtcgca----
I3K7B6_BAD-01      acacttgcccttcctgtaat-caaaacgacagtacaacccaaccagtggaa-cgcacttg
                   ****  *  * * *  *  * * **** ** * *    *   ** *****  ****    

I3K2D6_BMF-01      ----gaggagcccagaccactcttctacggtaacgcaggttttcgattgcacttcccggc
I3K7B6_BAD-01      gcatgagggatgaggacctcatggctagagg---ggaggatgaggtctgtactcc-----
                       ****      **** *    ***  *    * *** *   *  ** *** *     

I3K2D6_BMF-01      acgcttcgaactcgtcggggatcacagagcgaggcgacaagaaatcgcggagcagcaaaa
I3K7B6_BAD-01      ----------------------cacagagggagac-ccattcaggcgaaggtca--aagt
                                         ******* *** *  **   *  **  *  **  **  

I3K2D6_BMF-01      cagcatggagcgcctgccccggcagcgacctgcggctcgcagcgtggaggcctgcatcgg
I3K7B6_BAD-01      cag----------ctccccctgc-----tctgtgg---gctgccaagaagta-----cgg
                   ***          ** **** **      *** **   ** **   ** *       ***

I3K2D6_BMF-01      acagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccg
I3K7B6_BAD-01      ccagaagcttcgacggatgagtgacgagttt------gacagccta------------ct
                    ***** ** *  *  **  * *** *****      **  ****             * 

I3K2D6_BMF-01      aaaccaaaggaaccaggggccaatgtggtggcgcctggccgcggcccttctcagccttct
I3K7B6_BAD-01      agataaaggggagatgaagctcaagaagctgcaccactctaaaacctggtggagctacct
                   * *  ** ** *   *  **  * *  *  ** **   *     **      ***   **

I3K2D6_BMF-01      gtttga----cagggggttcatagccggaggagggggtggaggacggaggtga-
I3K7B6_BAD-01      ctttagtcaccaagagact-----------gaaggagagaacaaccatcttgaa
                    ***      ** * *  *           ** ** * * *  **     *** 

© 1998-2018