Dataset for CDS classical BH3-containing proteins of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1QHD8_HRK-01           atg-----------------------------------------------
G1S1X2_BIK-01           atgtccgaagtaagacccatctccagagacatcttgatggagagcctcct
A0A2I3HWI8_BBC3-03      atg-----------------------------------------------
A0A2I3HX97_PMAIP1-      a-------------------------------------------------
A0A2I3H4B2_BAD-01       atgggggaggag--------------------------------------
A0A2I3HD83_BMF-01       atgg---agcca--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
A0A2I3HW02_BCL2L11      atggcaaagcaa--------------------------------------
                        *                                                 

G1QHD8_HRK-01           --------------------------------------------------
G1S1X2_BIK-01           gtatgagcagctcctggaacccccgaccatggaggttcttggcgtgactg
A0A2I3HWI8_BBC3-03      --------------------------------aaatttggcatggggtc-
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3H4B2_BAD-01       ---------------------cc---------cagcccttttcgcggcc-
A0A2I3HD83_BMF-01       ---------------------tc-------------tcagtgtgtg---g
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
A0A2I3HW02_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtgaccg
                                                                          

G1QHD8_HRK-01           ---------------------------------------------tgccc
G1S1X2_BIK-01           accctgaagaggacctggaccctatggaggacttcgatcctttgcagtgc
A0A2I3HWI8_BBC3-03      ---------------------------------------------tgccc
A0A2I3HX97_PMAIP1-      ---------------------------------------------agcct
A0A2I3H4B2_BAD-01       -------------------------gctcgcgctcggcgccccccaacct
A0A2I3HD83_BMF-01       a---------------------ggagctagaggatgatgtgttccaacca
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
A0A2I3HW02_BCL2L11      a---------------------gaaggtagacaa-------ttgcagcct
                                                                          

G1QHD8_HRK-01           gtg-----ccccctgcaccgcggccgcggccccccggccgtgtg------
G1S1X2_BIK-01           atggaggg-------cagtgacgcgctggccccgcggct-----------
A0A2I3HWI8_BBC3-03      gggcatgtccatgccaggtgc----ccagggcttcttccgtgacgtgggt
A0A2I3HX97_PMAIP1-      g-ggagagcgcgcaggaacgctcaaccgag-ccccgcgc-----------
A0A2I3H4B2_BAD-01       ctggg----------cagcacagcgctatggccgcgagc-----------
A0A2I3HD83_BMF-01       gaggatggggagccgggcacccaacccggga--gcttgc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
A0A2I3HW02_BCL2L11      gcggagaggcctccccagctcagacctggggcccctacc-----------
                          *                               *               

G1QHD8_HRK-01           cgcctgcagcgcgggtcgcctggggct-----------------------
G1S1X2_BIK-01           ggcctgcat-----------cggggacgagatg-----------------
A0A2I3HWI8_BBC3-03      cccctgc-------------cagatttgtgcag-----------------
A0A2I3HX97_PMAIP1-      cggctccag-----------cagagct-ggaag-----------------
A0A2I3H4B2_BAD-01       tc------------------cggagg--atgag-----------------
A0A2I3HD83_BMF-01       tctctgctgacctgtttgcccagagcctactgg-----------------
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaag-----------------
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaag-----------------
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaagct--tccatgaggca--
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaaggtaatcctgaaggcaat
A0A2I3HW02_BCL2L11      tccctacaga----------cagagcc-acaaggtaatcctgaaggcaat
                                              *                           

G1QHD8_HRK-01           ----------------gcgctcgtccgccgcgcagctcaccgccgcccgg
G1S1X2_BIK-01           ---------gacgtgagcctcagggccccgcgcctggcccagctctccga
A0A2I3HWI8_BBC3-03      ------------------gcggtcccacccaggcggctccgggagtccgc
A0A2I3HX97_PMAIP1-      ----------ttgagtgtgctactcaactcaggagatttgga--------
A0A2I3H4B2_BAD-01       --------tgacgagtttgtggactcctttaagggacttc----------
A0A2I3HD83_BMF-01       -------------------actgccccctcagccgacttcagctcttccc
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      cacggaggtgaaggggacagctgcccccacggcagccctcag---ggccc
A0A2I3HW02_BCL2L11      cacggaggtgaaggggacagctgcccccacggcagccctcag---ggccc
A0A2I3HW02_BCL2L11      cacggaggtgaaggggacagctgcccccacggcagccctcag---ggccc
A0A2I3HW02_BCL2L11      cacggaggtgaaggggacagctgcccccacggcagccctcag---ggccc
A0A2I3HW02_BCL2L11      cacggaggtgaaggggacagctgcccccacggcagccctcag---ggccc
                                                                          

G1QHD8_HRK-01           ctcaaggcgctaggcgacgagct---------------------------
G1S1X2_BIK-01           ggtggccatgcacagcctgggtctggctttc-------------------
A0A2I3HWI8_BBC3-03      ggggaggaggaacag--tgggcccgg------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3H4B2_BAD-01       -ctcgcccgaaga-------------------------------------
A0A2I3HD83_BMF-01       tctcacccactgctg--tggccctggccttc-------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ------------ggc--tgaacctg-------------cagat-------
A0A2I3HW02_BCL2L11      gctggccccaccggc--cagccctggcccttttgctaccagatccccgct
A0A2I3HW02_BCL2L11      gctggccccaccggc--cagccctggcccttttgctaccagatccccgct
A0A2I3HW02_BCL2L11      gctggccccaccggc--cagccctggcccttttgctaccagatccccgct
A0A2I3HW02_BCL2L11      gctggccccaccggc--cagccctggcccttttgctaccagatccccgct
A0A2I3HW02_BCL2L11      gctggccccaccggc--cagccctggcccttttgctaccagatccccgct
                                                                          

G1QHD8_HRK-01           --------------------------------------------------
G1S1X2_BIK-01           ---------------------atctatgaccagactgaggacatcaggga
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ------------------atgcgcccggagatatggattgcccaagagtt
A0A2I3HW02_BCL2L11      tttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggt
A0A2I3HW02_BCL2L11      tttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggt
A0A2I3HW02_BCL2L11      tttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggt
A0A2I3HW02_BCL2L11      tttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggt
A0A2I3HW02_BCL2L11      tttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggt
                                                                          

G1QHD8_HRK-01           ------------------gcaccagcgcaccat-----------------
G1S1X2_BIK-01           tgttcttagaagtttcatggacggtttcaccacctttaaggagaacataa
A0A2I3HWI8_BBC3-03      ---------------gagatcggggcccagctgcggcgg-----------
A0A2I3HX97_PMAIP1-      ----------------------------gacaaactgaa-----------
A0A2I3H4B2_BAD-01       ------------------gcgcgggcacagcaacgcaga-----------
A0A2I3HD83_BMF-01       -----------------------gacccaccagccagga-----------
A0A2I3HW02_BCL2L11      ------------------acaggagcccagcacccatga-----------
A0A2I3HW02_BCL2L11      ------------------acaggagcccagcacccatga-----------
A0A2I3HW02_BCL2L11      gcggcgtatcggagac------gagtttaacgcttacta-----------
A0A2I3HW02_BCL2L11      atttctcttttgacacagacaggagcccagcacccatga-----------
A0A2I3HW02_BCL2L11      atttctcttttgacacagacaggagcccagcacccatga-----------
A0A2I3HW02_BCL2L11      atttctcttttgacacagacaggagcccagcacccatga-----------
A0A2I3HW02_BCL2L11      atttctcttttgacacagacaggagcccagcacccatga-----------
A0A2I3HW02_BCL2L11      atttctcttttgacacagacaggagcccagcacccatga-----------
                                                      *                   

G1QHD8_HRK-01           -gtggcggcgccgcgcgcggagccggagggcgccggcgcccggcgcgct-
G1S1X2_BIK-01           taaggctctggagatccccgaac---------cccgggtcccgggtgtc-
A0A2I3HWI8_BBC3-03      -atggcgg----acgacctcaac---------gcgcagtacgagcggcg-
A0A2I3HX97_PMAIP1-      -cttccggcagaaacttctgaat---------ctgatatccaa-------
A0A2I3H4B2_BAD-01       ---tgcggcaaagc------------------------tccagctggac-
A0A2I3HD83_BMF-01       -a----gacaaagctacccagac---------cctcagcccagcctcccc
A0A2I3HW02_BCL2L11      -gttgtgacaaatcaacacaaac---------cccaagtcctccttgcc-
A0A2I3HW02_BCL2L11      -gttgtgacaaatcaacacaaac---------cccaagtcctccttgcc-
A0A2I3HW02_BCL2L11      ---tgcaaggaggctggcaaaac---------tcctgg------------
A0A2I3HW02_BCL2L11      -gttgtgacaaatcaacacaaac---------cccaagtcctccttgcc-
A0A2I3HW02_BCL2L11      -gttgtgacaaatcaacacaaac---------cccaagtcctccttgcc-
A0A2I3HW02_BCL2L11      -gttgtgacaaatcaacacaaac---------cccaagtcctccttgcc-
A0A2I3HW02_BCL2L11      -gttgtgacaaatcaacacaaac---------cccaagtcctccttgcc-
A0A2I3HW02_BCL2L11      -gttgtgacaaatcaacacaaac---------cccaagtcctccttgcc-
                                                                          

G1QHD8_HRK-01           ----------------------------------------ccccacctac
G1S1X2_BIK-01           ------ccgcgaacagatgctgctggtgctgctggtgctgctgctgctgc
A0A2I3HWI8_BBC3-03      ---------------------------gagacaagaggagcaacagcggc
A0A2I3HX97_PMAIP1-      ------------------------------------------------ac
A0A2I3H4B2_BAD-01       ---------------------------------------------gcgag
A0A2I3HD83_BMF-01       cagccaaggtgtcatgctgccttgtggggtgactgaggaaccccagcgac
A0A2I3HW02_BCL2L11      ------------------------------------aggccttcaaccac
A0A2I3HW02_BCL2L11      ------------------------------------aggccttcaaccac
A0A2I3HW02_BCL2L11      -------------------------------------------catcctc
A0A2I3HW02_BCL2L11      ------------------------------------aggccttcaaccac
A0A2I3HW02_BCL2L11      ------------------------------------aggccttcaaccac
A0A2I3HW02_BCL2L11      ------------------------------------aggccttcaaccac
A0A2I3HW02_BCL2L11      ------------------------------------aggccttcaaccac
A0A2I3HW02_BCL2L11      ------------------------------------aggccttcaaccac
                                                                          

G1QHD8_HRK-01           tggccctggctgtgcgcggccgcgcaggtggcggcgctggcggcctggct
G1S1X2_BIK-01           tgctgccgctgctcagcgggggcctgtacctgctgaattga---------
A0A2I3HWI8_BBC3-03      accgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
A0A2I3HX97_PMAIP1-      tcttctgct-------caggaacctga-----------------------
A0A2I3H4B2_BAD-01       tcttccagt---cctggtgggatcggaacttgggcaggggaagctccgcc
A0A2I3HD83_BMF-01       tctttta-tgcaccagcagaaccgaaatcgcgtgtggtggcagatcctcc
A0A2I3HW02_BCL2L11      tatctcagtgcaatggtagtcatcctagaggatgtaggtgatatttcact
A0A2I3HW02_BCL2L11      tatctcagtgcaatggatgaggccgctggatcctccctcgaagttcagtg
A0A2I3HW02_BCL2L11      cacctga-------------------------------------------
A0A2I3HW02_BCL2L11      tatctcagtgcaatggtt--------------------------------
A0A2I3HW02_BCL2L11      tatctcagtgcaat------------------------------------
A0A2I3HW02_BCL2L11      tatctcagtgcaatggcttccatgaggcaggctgaacctgcagatatgcg
A0A2I3HW02_BCL2L11      tatctcagtgcaatggcttccatgaggcaggctgaacctgcagatatgcg
A0A2I3HW02_BCL2L11      tatctcagtgcaat------------------------------------
                                                                          

G1QHD8_HRK-01           gctcggcaggcggaacttgtag----------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-03      cccttacccaggggccac--------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3H4B2_BAD-01       ccctcccagtga--------------------------------------
A0A2I3HD83_BMF-01       tcttcctgcaca--------------------------------------
A0A2I3HW02_BCL2L11      gtggtttggatttatatttactg---------------------------
A0A2I3HW02_BCL2L11      gccattcgagtggtt-----------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ---agagaaataga------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      cccggagatatggattgcccaagagttgcggcgtatcggagacgagttta
A0A2I3HW02_BCL2L11      cccggagatatggattgcccaagagttgcggcgtatcggagacgagttta
A0A2I3HW02_BCL2L11      --------------------------------------------------
                                                                          

G1QHD8_HRK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-03      ------------------agagcccccgagatggagcccaattag-----
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I3HD83_BMF-01       ------------------accttgctttgaatggagaagagaacaggaat
A0A2I3HW02_BCL2L11      ------------------gcttagatttgtatggccaccaccatagtcaa
A0A2I3HW02_BCL2L11      ------------------agcaaaatcaagctaa----------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ------------------ggaagttgtcgtgtag----------------
A0A2I3HW02_BCL2L11      ------------------ggctaactgggactag----------------
A0A2I3HW02_BCL2L11      acgcttactatgcaaggaggtta-----gagaaatag-------------
A0A2I3HW02_BCL2L11      acgcttactatgcaaggagggtatttttgaataattaccaagcagccgaa
A0A2I3HW02_BCL2L11      ------------------gggtatttttgaataa----------------
                                                                          

G1QHD8_HRK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I3HD83_BMF-01       ggggcaggccctag------------------------------------
A0A2I3HW02_BCL2L11      gatacagaacaattcaaccacaaggatttctcatga--------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      gaccacccacgaatggttatcttacgactgttacgttacattgtccgcct
A0A2I3HW02_BCL2L11      --------------------------------------------------
                                                                          

G1QHD8_HRK-01           -------------------
G1S1X2_BIK-01           -------------------
A0A2I3HWI8_BBC3-03      -------------------
A0A2I3HX97_PMAIP1-      -------------------
A0A2I3H4B2_BAD-01       -------------------
A0A2I3HD83_BMF-01       -------------------
A0A2I3HW02_BCL2L11      -------------------
A0A2I3HW02_BCL2L11      -------------------
A0A2I3HW02_BCL2L11      -------------------
A0A2I3HW02_BCL2L11      -------------------
A0A2I3HW02_BCL2L11      -------------------
A0A2I3HW02_BCL2L11      -------------------
A0A2I3HW02_BCL2L11      ggtgtggagaatgcattga
A0A2I3HW02_BCL2L11      -------------------
                                           

© 1998-2018