Dataset for CDS BCL2L11 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3HW02_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3HW02_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2I3HW02_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2I3HW02_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2I3HW02_BCL2L11      cctccctacagacagagccacaagct--tccatgaggca-----------
A0A2I3HW02_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3HW02_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3HW02_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3HW02_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3HW02_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
                        ************************                          

A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3HW02_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3HW02_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3HW02_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3HW02_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                          

A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ggctgaacctg-------------cagat---------------------
A0A2I3HW02_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3HW02_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3HW02_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3HW02_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3HW02_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                                                                          

A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ----atgcgcccggagatatggattgcccaagagttgcggcgtatcggag
A0A2I3HW02_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3HW02_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3HW02_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3HW02_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3HW02_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A2I3HW02_BCL2L11      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3HW02_BCL2L11      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3HW02_BCL2L11      ac------gagtttaacgcttacta--tgcaaggaggctggcaaaactcc
A0A2I3HW02_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3HW02_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3HW02_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3HW02_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3HW02_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                ***   * * *  *  *  **  *  *  *     **** **

A0A2I3HW02_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
A0A2I3HW02_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggatgagg
A0A2I3HW02_BCL2L11      tgg------------------catcctccacctga---------------
A0A2I3HW02_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
A0A2I3HW02_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
A0A2I3HW02_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3HW02_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3HW02_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
                          *                  ** ** * * ** *               

A0A2I3HW02_BCL2L11      tcctagaggatgtaggtgatatttcactgtggtttggatttatatttact
A0A2I3HW02_BCL2L11      ccgctggatcctccctcgaagttcagtggccattcgagtggtt-------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      -------------------------------agagaaataga--------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaa
A0A2I3HW02_BCL2L11      tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaa
A0A2I3HW02_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3HW02_BCL2L11      ggcttagatttgtatggccaccaccatagtcaagatac--------agaa
A0A2I3HW02_BCL2L11      ----------------------------------------------agca
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ----------------------------------------------ggaa
A0A2I3HW02_BCL2L11      ----------------------------------------------ggct
A0A2I3HW02_BCL2L11      gagttgcggcgtatcggagacgagtttaacgcttactatgcaaggaggtt
A0A2I3HW02_BCL2L11      gagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
A0A2I3HW02_BCL2L11      ----------------------------------------------gggt
                                                                          

A0A2I3HW02_BCL2L11      caattcaaccacaaggatttctcatga-----------------------
A0A2I3HW02_BCL2L11      aaatcaagctaa--------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      gttgtcgtgtag--------------------------------------
A0A2I3HW02_BCL2L11      aactgggactag--------------------------------------
A0A2I3HW02_BCL2L11      a-----gagaaatag-----------------------------------
A0A2I3HW02_BCL2L11      atttttgaataattaccaagcagccgaagaccacccacgaatggttatct
A0A2I3HW02_BCL2L11      atttttgaataa--------------------------------------
                                                                          

A0A2I3HW02_BCL2L11      -----------------------------------------------
A0A2I3HW02_BCL2L11      -----------------------------------------------
A0A2I3HW02_BCL2L11      -----------------------------------------------
A0A2I3HW02_BCL2L11      -----------------------------------------------
A0A2I3HW02_BCL2L11      -----------------------------------------------
A0A2I3HW02_BCL2L11      -----------------------------------------------
A0A2I3HW02_BCL2L11      tacgactgttacgttacattgtccgcctggtgtggagaatgcattga
A0A2I3HW02_BCL2L11      -----------------------------------------------
                                                                       

© 1998-2018