Dataset for CDS classical BH3-containing proteins of organism Neolamprologus brichardi

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q4G1I4_BMF-01      atggacga-----tgagga----ggacgatgtgtttgagcca--------
A0A3Q4GGN3_BAD-01      atggctgcaaacttcaaaatttcagacagtgattcagagacatcagagga
                       ****  *      * *  *     ***  **  *  *** **        

A0A3Q4G1I4_BMF-01      --------------aaagccaactgttggcgcaccacattcagggagata
A0A3Q4GGN3_BAD-01      ggtaggggaaggagaaaaccaacagtcagcaagacaagttcaagaaagca
                                     *** ***** **  **    **  **** * *   *

A0A3Q4G1I4_BMF-01      aagtgtgaacatcgaggcacacagacacccggtcctgccctggtacc-aa
A0A3Q4GGN3_BAD-01      ag----------------ccccagacgctc--tcccttcctgtaatcaaa
                       *                  * ***** * *  ***   ****  * * **

A0A3Q4G1I4_BMF-01      acaacggcatgctgccctgtggagtcgcagag-gagcccaga---ccact
A0A3Q4GGN3_BAD-01      acgacagc-tgctg------gaaggctcagggtgaactcagagtcccaca
                       ** ** ** *****      * ** * *** * ** * ****   **** 

A0A3Q4G1I4_BMF-01      cttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagc
A0A3Q4GGN3_BAD-01      cttc----------------ctcaattg-----ccagggatgag--gagc
                       ****                 ** ****     ** ** * *    ****

A0A3Q4G1I4_BMF-01      tcgt------cgggga-----------------tcacagagcgagtcgac
A0A3Q4GGN3_BAD-01      tcatggctagaggggaggatgaggtctgtactcccacagagggagac-cc
                       ** *       *****                  ******* *** *  *

A0A3Q4G1I4_BMF-01      aaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcga
A0A3Q4GGN3_BAD-01      attcaggcgaaggtca--aagtcagctc----cccctgctctgtgggctg
                       *   * **   *  **  **  ****      * ***** * *   **  

A0A3Q4G1I4_BMF-01      cccgcggctcgcagcgtggaggcctgcatcggacagaaactccagctcat
A0A3Q4GGN3_BAD-01      cc----------------aagaagtacggcaggcag---cttcgacgaat
                       **                 **   * *  * * ***   ** *  *  **

A0A3Q4G1I4_BMF-01      aggagaccagtttcactgggaacgcctgcaactgtatcaacgaaaccaaa
A0A3Q4GGN3_BAD-01      gagtgacgagtttgacag------------------cttactagataaag
                         * *** ***** ** *                     ** * *  ** 

A0A3Q4G1I4_BMF-01      ggaaccaggggccgatgtggtggcgcctggccgcggccattctcagcctt
A0A3Q4GGN3_BAD-01      gggagatgaagctcaagaagctgcaccactctaaaacctggtggagctat
                       ** *   *  **  * *  *  ** **   *     **      ***  *

A0A3Q4G1I4_BMF-01      ctgtttgat----agggggttcatagccggaggaggggg--------tgg
A0A3Q4GGN3_BAD-01      ctctttagtcaccaagag-------actgaaggagagaacaaccatcttg
                       ** ***  *    * * *        * * ***** *          * *

A0A3Q4G1I4_BMF-01      aggacgg-------------aggtga
A0A3Q4GGN3_BAD-01      aaaaccacaaccaacgcactgagtaa
                       *  **                 ** *

© 1998-2019