Dataset for CDS classical BH3-containing proteins of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O54918_BCL2L11-03      atggccaag-----------------------------------------
O54918_BCL2L11-01      atggccaag-----------------------------------------
O54918_BCL2L11-05      atggccaag-----------------------------------------
O54918_BCL2L11-06      atggccaag-----------------------------------------
O54918_BCL2L11-08      atggccaag-----------------------------------------
Q61337_BAD-02          atggg---------------------------------------------
Q61337_BAD-01          atggg---------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q9JM54_PMAIP1-01       atgcc---------------------------------------------
P62816_HRK-03          atgt----------------------------------------------
Q99ML1_BBC3-02         atggc---------------------------------------------
A2AV74_BMF-01          atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccgtgg
A2AV74_BMF-02          atgtc---------------------------------------------
O70337_BIK-01          atgtcggaggcgag------------------------------------
O70337_BIK-02          atgtcggaggcgag------------------------------------
O70337_BIK-04          atgtt---------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          ---aaccccaaagcagccctcgctggctcctgcacacgccctaggcttga
Q61337_BAD-01          ---aaccccaaagcagccctcgctggctcctgcacacgccctaggcttga
Q61337_BAD-03          --------------------------------------------------
Q9JM54_PMAIP1-01       ------------------------------------------------cg
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------ccgcgcacgcca
A2AV74_BMF-01          cctcctcccgcgccagctcgcgcctgcagcagtcgctgccgcagcccgcg
A2AV74_BMF-02          --------------------------------------------------
O70337_BIK-01          ------------------------------acttatggccagagacgtca
O70337_BIK-02          ------------------------------acttatggccagagacgtca
O70337_BIK-04          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          ggaagtccgatcccggaatccggag-------------------------
Q61337_BAD-01          ggaagtccgatcccggaatccggag-------------------------
Q61337_BAD-03          --------------------------------------------------
Q9JM54_PMAIP1-01       ggagaaaggcgcgtcggaacgcgcc-------------------------
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         ggagggcagctctccggagcccgta-------------------------
A2AV74_BMF-01          ccaccgcctcccaccgcagcccgctggagtttgcccccttcttcccaatc
A2AV74_BMF-02          --------------------------------------------------
O70337_BIK-01          tcaagactgttccacacgaccaggt----------------cccccaacc
O70337_BIK-02          tcaagactgttccacacgaccaggt----------------cccccaacc
O70337_BIK-04          --------------cac---------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
A2AV74_BMF-01          gagtgtgggcaccaagccccccgagtgttcttcaccctggaccctggcgc
A2AV74_BMF-02          --------------------------------------------------
O70337_BIK-01          tccagtggcctctgagactcccag--------------------------
O70337_BIK-02          tccagtggcctctgagactcccag--------------------------
O70337_BIK-04          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          -------------------------cctggggagcgacgcgggaggaagg
Q61337_BAD-01          -------------------------cctggggagcgacgcgggaggaagg
Q61337_BAD-03          --------------------------------------------------
Q9JM54_PMAIP1-01       ------------------------------------------agtgaacc
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------gagggtctagcc
A2AV74_BMF-01          agagccctggcatcacaactcggaggctgagacgctgtcctggagtcacc
A2AV74_BMF-02          ------------------------------------------------cc
O70337_BIK-01          --------------------------------------catgaaggagcc
O70337_BIK-02          --------------------------------------catgaaggagcc
O70337_BIK-04          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          cggtggagaccagcagcccagagtatgttccagatcccagagtttgagcc
Q61337_BAD-01          cggtggagaccagcagcccagagtatgttccagatcccagagtttgagcc
Q61337_BAD-03          ------------------------atgttccagatcccagagtttgagcc
Q9JM54_PMAIP1-01       caacgcgggcagagctacc-------------------------------
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         cgcgacagtccgcgccccttcc---cgctcggccgcctga------tgcc
A2AV74_BMF-01          caggagagatggagccacctcagtgtgtggaggagctagaagatgatgtg
A2AV74_BMF-02          caggagagatggagccacctcagtgtgtggaggagctagaagatgatgtg
O70337_BIK-01          tgtgagagacgtggacctcatggagtgcgtggaaggcaga----------
O70337_BIK-02          tgtgagagacgtggacctcatggagtgcgtggaaggcaga----------
O70337_BIK-04          ------------------------------------caga----------

O54918_BCL2L11-03      ---------------------------------------------caacc
O54918_BCL2L11-01      ---------------------------------------------caacc
O54918_BCL2L11-05      ---------------------------------------------caacc
O54918_BCL2L11-06      ---------------------------------------------caacc
O54918_BCL2L11-08      ---------------------------------------------caacc
Q61337_BAD-02          gagtgagcaggaagacgctagtgctacagataggggcctgggccctagcc
Q61337_BAD-01          gagtgagcaggaagacgctagtgctacagataggggcctgggccctagcc
Q61337_BAD-03          gagtgagcaggaagacgctagtgctacagataggggcctgggccctagcc
Q9JM54_PMAIP1-01       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         ---------------ctccgct----------gtatcctg-----cagcc
A2AV74_BMF-01          ---------------ttccagtcagaggatggggagccagggacacagcc
A2AV74_BMF-02          ---------------ttccagtcagaggatggggagccagggacacagcc
O70337_BIK-01          ----------------------------------aaccagg----tggcc
O70337_BIK-02          ----------------------------------aaccagg----tggcc
O70337_BIK-04          ----------------------------------aaccagg----tggcc

O54918_BCL2L11-03      tt-------ctgatgtaagttctgagtgtgacagagaaggt------gga
O54918_BCL2L11-01      tt-------ctgatgtaagttctgagtgtgacagagaaggt------gga
O54918_BCL2L11-05      tt-------ctgatgtaagttctgagtgtgacagagaaggt------gga
O54918_BCL2L11-06      tt-------ctgatgtaagttctgagtgtgacagagaaggt------gga
O54918_BCL2L11-08      tt-------ctgatgtaagttctgagtgtgacagagaaggt------gga
Q61337_BAD-02          tcactgaggaccagccaggtccctacc----tggccccaggtctcctggg
Q61337_BAD-01          tcactgaggaccagccaggtccctacc----tggccccaggtctcctggg
Q61337_BAD-03          tcactgaggaccagccaggtccctacc----tggccccaggtctcctggg
Q9JM54_PMAIP1-01       ------------acctgagttcgcagctcaactcaggaagatcgga-gac
P62816_HRK-03          ------------gcccgtgtccccggcatcgcggccgcgggccccc-gg-
Q99ML1_BBC3-02         tttgcgagcccggcctgc-ccgccgcccctgctgcccctgccttgc-tgc
A2AV74_BMF-01          tg---ggggcttgctctc--tgctgacctgtttgcccagagccagc-tg-
A2AV74_BMF-02          tg---ggggcttgctctc--tgctgacctgtttgcccagagccagc-tg-
O70337_BIK-01          tt---gaggctggcctgcatcggcgatgagatggacctgtgtctgc-gg-
O70337_BIK-02          tt---gaggctggcctgcatcggcgatgagatggacctgtgtctgc-gg-
O70337_BIK-04          tt---gaggctggcctgcatcggcgatgagatggacctgtgtctgc-gg-

O54918_BCL2L11-03      caattgcagcctgctgagaggcctccc-----------------------
O54918_BCL2L11-01      caattgcagcctgctgagaggcctccc-----------------------
O54918_BCL2L11-05      caattgcagcctgctgagaggcctccc-----------------------
O54918_BCL2L11-06      caattgcagcctgctgagaggcctccc-----------------------
O54918_BCL2L11-08      caattgcagcctgctgagaggcctccc-----------------------
Q61337_BAD-02          gagcaacattcatcagcagggacgggcagccaccaacagtcatcatggag
Q61337_BAD-01          gagcaacattcatcagcagggacgggcagccaccaacagtcatcatggag
Q61337_BAD-03          gagcaacattcatcagcagggacgggcagccaccaacagtcatcatggag
Q9JM54_PMAIP1-01       aaagtgtattgcacgtggagtgcaccg-----------------------
P62816_HRK-03          ---------ccgtgtgcggttgcggcg-----------------------
Q99ML1_BBC3-02         cggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgcc
A2AV74_BMF-01          -gactgtcccctcagtcgactccagctcttccctctcacccattgctg--
A2AV74_BMF-02          -gactgtcccctcagtcgactccagctcttccctctcacccattgctg--
O70337_BIK-01          -ag------cccccgtctggtccagct-----------------------
O70337_BIK-02          -ag------cccccgtctggtccagct-----------------------
O70337_BIK-04          -ag------cccccgtctggtccagct-----------------------

O54918_BCL2L11-03      ---------cagctcaggcctggggcc-----------------------
O54918_BCL2L11-01      ---------cagctcaggcctggggcc-----------------------
O54918_BCL2L11-05      ---------cagctcaggcctggggcc-----------------------
O54918_BCL2L11-06      ---------cagctcaggcctggggcc-----------------------
O54918_BCL2L11-08      ---------cagctcaggcctggggcc-----------------------
Q61337_BAD-02          gcgcaggggctatggagactcggagtc-------------------gcca
Q61337_BAD-01          gcgcaggggctatggagactcggagtc-------------------gcca
Q61337_BAD-03          gcgcaggggctatggagactcggagtc-------------------gcca
Q9JM54_PMAIP1-01       ------------gacataactgtggtt-----------------------
P62816_HRK-03          -----------acgctcgccccgggct-----------------gcgctg
Q99ML1_BBC3-02         ctggggggcccccgctggcctgggggtcaccgcagccggcccagaggccc
A2AV74_BMF-01          ---------------tggtcccggact--------ccggcccataagcca
A2AV74_BMF-02          ---------------tggtcccggact--------ccggcccataagcca
O70337_BIK-01          -----------------gcctgggatt-------------------gcta
O70337_BIK-02          -----------------gcctgggatt-------------------gcta
O70337_BIK-04          -----------------gcctgggatt-------------------gcta

O54918_BCL2L11-03      ----cctacctccctacagacagaaccgca--------------------
O54918_BCL2L11-01      ----cctacctccctacagacagaaccgcaaggtaatcccgacggcgaag
O54918_BCL2L11-05      ----cctacctccctacagacagaaccgca--------------------
O54918_BCL2L11-06      ----cctacctccctacagacagaaccgca--------------------
O54918_BCL2L11-08      ----cctacctccctacagacagaaccgca--------------------
Q61337_BAD-02          cagttcgtacccagcggggaccgaggagga--------------------
Q61337_BAD-01          cagttcgtacccagcggggaccgaggagga--------------------
Q61337_BAD-03          cagttcgtacccagcggggaccgaggagga--------------------
Q9JM54_PMAIP1-01       -------------------------ctggc--------------------
P62816_HRK-03          gg---------------------cggcggc--------------------
Q99ML1_BBC3-02         gcgcccggacggtcctcagccctccctgtc--------------------
A2AV74_BMF-01          ggaagacaaggccactcagacc-ctcagtc--------------------
A2AV74_BMF-02          ggaagacaaggccactcagacc-ctcagtc--------------------
O70337_BIK-01          ------------tacacagact-cgctgtc--------------------
O70337_BIK-02          ------------tacacagact-cgctgtc--------------------
O70337_BIK-04          ------------tacacagact-cgctgtc--------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      gggaccgctgcccccacggcagccctcagggcccgctggccccaccggcc
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
A2AV74_BMF-01          --------------------------------------------------
A2AV74_BMF-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      agccctggcccttttgctaccagatccccacttttcatctttgtgagaag
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
A2AV74_BMF-01          --------------------------------------------------
A2AV74_BMF-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------

O54918_BCL2L11-03      ------------------------------------------------ag
O54918_BCL2L11-01      atcttctctgctgtcccggtcctccagtgggtatttctcttttgacacag
O54918_BCL2L11-05      ------------------------------------------------ag
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          ----------------t---------------------------------
Q61337_BAD-01          ----------------t---------------------------------
Q61337_BAD-03          ----------------t---------------------------------
Q9JM54_PMAIP1-01       ----------------g---------------------------------
P62816_HRK-03          ----------------g---------------------------------
Q99ML1_BBC3-02         ----------------a--------ccagcccag----------------
A2AV74_BMF-01          ----------------cagcttccccaagccagggtgtcatgctgccttg
A2AV74_BMF-02          ----------------cagcttccccaagccagggtgtcatgctgccttg
O70337_BIK-01          ----------------a-----cctacagccgga----------------
O70337_BIK-02          ----------------a-----cctacagccgga----------------
O70337_BIK-04          ----------------a-----cctacagccgga----------------

O54918_BCL2L11-03      acaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagt
O54918_BCL2L11-01      acaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagt
O54918_BCL2L11-05      acaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagt
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-02          -gaagggatgg-------------------aggaggagcttagccctttt
Q61337_BAD-01          -gaagggatgg-------------------aggaggagcttagccctttt
Q61337_BAD-03          -gaagggatgg-------------------aggaggagcttagccctttt
Q9JM54_PMAIP1-01       -cagatgcctg-------------------ggaag--------------t
P62816_HRK-03          -caggtgaccg-------------------cgctg-----------cggc
Q99ML1_BBC3-02         -cagcacttag-------------------agtcg-cccgtgcccagcgc
A2AV74_BMF-01          tggggtgacag-------------------aggaaccccagagactcttt
A2AV74_BMF-02          tggggtgacag-------------------aggaaccccagagactcttt
O70337_BIK-01          -caggtgtcag-------------------aggta-------------tt
O70337_BIK-02          -caggtgtcag-------------------aggta-------------tt
O70337_BIK-04          -caggtgtcag-------------------aggta-------------tt

O54918_BCL2L11-03      cctccttgccaggccttcaaccacta------------------------
O54918_BCL2L11-01      cctccttgccaggccttcaaccactatctcagtgcaatggcttccatacg
O54918_BCL2L11-05      cctccttgccaggccttcaaccactatctcagtgcaatggcttccatacg
O54918_BCL2L11-06      --------------------------------------agcttccatacg
O54918_BCL2L11-08      --------------------------------------agcttccatacg
Q61337_BAD-02          cgaggacgctcgcgttcggctcccc-------------------------
Q61337_BAD-01          cgaggacgctcgcgttcggctcccc-------------------------
Q61337_BAD-03          cgaggacgctcgcgttcggctcccc-------------------------
Q9JM54_PMAIP1-01       cgcaaaagagcaggatgaggagccc----------------------aag
P62816_HRK-03          tgcaggcgc-tgggcgacgagctgc------------------------a
Q99ML1_BBC3-02         cccggaggccctggcaggaggcccc------------------------a
A2AV74_BMF-01          tacggcaacgctggctacaggcttcctctccctgccagtttccctgcagg
A2AV74_BMF-02          tacggcaacgctggctacaggcttcctctccctgccagtttccctgcagg
O70337_BIK-01          ttcaggagc-ttgattcgaagcctc------------------------a
O70337_BIK-02          ttcaggagc-ttgattcgaagcctc------------------------a
O70337_BIK-04          ttcaggagc-ttgattcgaagcctc------------------------a

O54918_BCL2L11-03      ----t----ctcag------------------------------------
O54918_BCL2L11-01      acagt----ctcaggagga-acctgaagatctgc----------------
O54918_BCL2L11-05      acagt----ctcaggagga-acctgaagatctgc----------------
O54918_BCL2L11-06      acagt----ctcaggagga-acctgaagatctgc----------------
O54918_BCL2L11-08      acagt----ctcaggagga-acctgaagatctgc----------------
Q61337_BAD-02          ccaat----ctctgggcagcgca---------------------------
Q61337_BAD-01          ccaat----ctctgggcagcgca---------------------------
Q61337_BAD-03          ccaat----ctctgggcagcgca---------------------------
Q9JM54_PMAIP1-01       cccaa----cccgggt----gccagcagacttgaaggac-----------
P62816_HRK-03          ccgacgcgccatgcggcgtcgcgcgcggccccgggacccgctgcccgcgc
Q99ML1_BBC3-02         cccaagctgccccgggagt-gcgtgtggaggaggaggagt----------
A2AV74_BMF-01          ctcac----cccttgggga-gcagcc--ccctgaaggacagttccttcag
A2AV74_BMF-02          ctcac----cccttgggga-gcagcc--ccctgaaggacagttccttcag
O70337_BIK-01          ccaac----ctcagggaaa-acatctggtcctggagagtcttgactcctg
O70337_BIK-02          ccaac----ctcagggaaa-acatctggtcctggagagtcttgactcctg
O70337_BIK-04          ccaac----ctcagggaaa-acatctggtcctggagagtcttgactcctg

O54918_BCL2L11-03      -------------------------------tgcaatggatcag------
O54918_BCL2L11-01      ----gcccggagatacggattgcacaggagctgcggcggatcggagacga
O54918_BCL2L11-05      ----gcccggagatacggattgcacaggagctgcggcggatcggagacga
O54918_BCL2L11-06      ----gcccggagatacggattgcacaggagctgcggcggatcggagacga
O54918_BCL2L11-08      ----gcccggagatacggattgcacaggagctgcggcggatcggagacga
Q61337_BAD-02          --------------gcgctacggccgtgagctccgaaggatgagcgatga
Q61337_BAD-01          --------------gcgctacggccgtgagctccgaaggatgagcgatga
Q61337_BAD-03          --------------gcgctacggccgtgagctccgaaggatgagcgatga
Q9JM54_PMAIP1-01       ----------gagtg--------tgctcaactccggaggattggagacaa
P62816_HRK-03          tgctgccc----gcgctccgcgcccgctggccctggctgtgcgcgg----
Q99ML1_BBC3-02         ----gggcccgggag---atcggggcccagctgcggcggatggcggacga
A2AV74_BMF-01          caccgagcagaggtgcagatcgccagaaagcttcagtgtattgcagac--
A2AV74_BMF-02          caccgagcagaggtgcagatcgccagaaagcttcagtgtattgcagac--
O70337_BIK-01          ----gcgcctgggtg----tcac--------------------ctgac--
O70337_BIK-02          ----gcgcctgggtg----tcac--------------------ctgac--
O70337_BIK-04          ----gcgcctgggtg----tcac--------------------ctgac--

O54918_BCL2L11-03      --ttggagaatcttaaccaag-----------------------------
O54918_BCL2L11-01      gttcaacgaaacttacacaagga---------------------------
O54918_BCL2L11-05      gttcaacgaaacttacacaagga---------------------------
O54918_BCL2L11-06      gttcaacgaaacttacacaagga---------------------------
O54918_BCL2L11-08      gttcaacgaaacttacacaagga---------------------------
Q61337_BAD-02          gtttgagggttccttcaaggga-----------gaagagc----------
Q61337_BAD-01          gtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactg
Q61337_BAD-03          gtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactg
Q9JM54_PMAIP1-01       agtgaatttacggcagaaacttc---------------------------
P62816_HRK-03          ----------ccgcgcaggtggc---------------------------
Q99ML1_BBC3-02         cctcaacgcgcagtacgagcggc-----------ggagacaagaagagca
A2AV74_BMF-01          ----------cagttccatcggcttcat-----acgcaacaacaccagca
A2AV74_BMF-02          ----------cagttccatcggcttcat-----acgcaacaacaccagca
O70337_BIK-01          ----------caggaccctgggc---------------------------
O70337_BIK-02          ----------caggaccctgggc---------------------------
O70337_BIK-04          ----------caggaccctgggc---------------------------

O54918_BCL2L11-03      -------------------------------tggcacaaaatatccacgg
O54918_BCL2L11-01      -------------------------gggtgtttgcaaatgattaccgcga
O54918_BCL2L11-05      -------------------------gggtgtttgcaaatgattaccgcga
O54918_BCL2L11-06      -------------------------gggtgtttgcaaatgattaccgcga
O54918_BCL2L11-08      -------------------------gggtgtttgcaaatgattaccgcga
Q61337_BAD-02          ---------------------------tgacgtaca--------------
Q61337_BAD-01          caacacagatgcgacaaagcgccggctggacgcgcattatccagtcctgg
Q61337_BAD-03          caacacagatgcgacaaagcgccggctggacgcgcattatccagtcctgg
Q9JM54_PMAIP1-01       ----------tgaatttgatttccaagc-------------tcttcaatt
P62816_HRK-03          -----------------ggcgctggcgg----------------cctggc
Q99ML1_BBC3-02         gcatcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgg
A2AV74_BMF-01          gaaccgagaccgtgcgtggtg--gcagg-------------tcttccttt
A2AV74_BMF-02          gaaccgagaccgtgcgtggtg--gcagg-------------tcttccttt
O70337_BIK-01          -agctgtttccg---atggtgctgctgg-------------tcttcttgc
O70337_BIK-02          -agctgtttccg---atggtgctgctgg-------------tcttcttgc
O70337_BIK-04          -agctgtttccg---atggtgctgctgg-------------tcttcttgc

O54918_BCL2L11-03      tgat----------------------------------------------
O54918_BCL2L11-01      ggctgaagaccaccctcaaatggttatcttacaactgttacgctttatct
O54918_BCL2L11-05      ggctgaagaccaccctcaaatggttatcttacaactgttacgctttatct
O54918_BCL2L11-06      ggctgaagaccaccctcaaatggttatcttacaactgttacgctttatct
O54918_BCL2L11-08      ggctgaagaccaccctcaaatggttatcttacaactgttacgctttatct
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          tgggatcgaaactt----------------------------gggcaaag
Q61337_BAD-03          tgggatcgaaactt----------------------------gggcaaag
Q9JM54_PMAIP1-01       tagt----------------------------------------------
P62816_HRK-03          tgct--------------------------------------cggcaggc
Q99ML1_BBC3-02         gact------cctccccttaccca------------------gggatcct
A2AV74_BMF-01          tccttcaaaacctcgccctgaacagacaagaaaacagggaagggg----t
A2AV74_BMF-02          tccttcaaaacctcgccctgaacagacaagaaaacagggaagggg----t
O70337_BIK-01          tgct--------------------------------------ggg----t
O70337_BIK-02          tgct--------------------------------------ggg----t
O70337_BIK-04          tgct--------------------------------------ggg----t

O54918_BCL2L11-03      ---gcctggtaca---------actga---------
O54918_BCL2L11-01      tccgtctggtatggagaaggc-attga---------
O54918_BCL2L11-05      tccgtctggtatggagaaggc-attga---------
O54918_BCL2L11-06      tccgtctggtatggagaaggc-attga---------
O54918_BCL2L11-08      tccgtctggtatggagaaggc-attga---------
Q61337_BAD-02          ---gcttga----gtcccttccggtgcgtgcaatag
Q61337_BAD-01          gaggctcca----ccccctcccagtga---------
Q61337_BAD-03          gaggctcca----ccccctcccagtga---------
Q9JM54_PMAIP1-01       --aacctga---------------------------
P62816_HRK-03          ggagcgc----------------gtag---------
Q99ML1_BBC3-02         ggagccccagaaatggagcccaactag---------
A2AV74_BMF-01          ggggccctg--------------gtga---------
A2AV74_BMF-02          ggggccctg--------------gtga---------
O70337_BIK-01          ggggcctggtatttgcagcttcagtga---------
O70337_BIK-02          ggggcctggtatttgcagcttcagtga---------
O70337_BIK-04          ggggcctggtatttgcagcttcagtga---------

© 1998-2019