Dataset for CDS BIK of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O70337_BIK-04      atgtt-------------------------------------------cac---------
O70337_BIK-01      atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtc
O70337_BIK-02      atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtc
O70337_BIK-03      atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtc
                   ****                                            ***         

O70337_BIK-04      ------------------------------------------------------------
O70337_BIK-01      ccccaacctccagtggcctctgagactcccagcatgaaggagcctgtgagagacgtggac
O70337_BIK-02      ccccaacctccagtggcctctgagactcccagcatgaaggagcctgtgagagacgtggac
O70337_BIK-03      ccccaacctccagtggcctctgagactcccagcatgaaggagcctgtgagagacgtggac
                                                                               

O70337_BIK-04      --------------------cagaaaccaggtggccttgaggctggcctgcatcggcgat
O70337_BIK-01      ctcatggagtgcgtggaaggcagaaaccaggtggccttgaggctggcctgcatcggcgat
O70337_BIK-02      ctcatggagtgcgtggaaggcagaaaccaggtggccttgaggctggcctgcatcggcgat
O70337_BIK-03      ctcatggagtgcgtggaaggcagaaaccaggtggccttgaggctggcctgcatcggcgat
                                       ****************************************

O70337_BIK-04      gagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
O70337_BIK-01      gagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
O70337_BIK-02      gagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
O70337_BIK-03      gagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
                   ************************************************************

O70337_BIK-04      agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcga
O70337_BIK-01      agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcga
O70337_BIK-02      agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcga
O70337_BIK-03      agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcga
                   ************************************************************

O70337_BIK-04      agcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgg
O70337_BIK-01      agcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgg
O70337_BIK-02      agcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgg
O70337_BIK-03      agcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgg
                   ************************************************************

O70337_BIK-04      gtgtcacctgaccaggaccctgggcagctgtttccgatggtgctgctggtcttcttgctg
O70337_BIK-01      gtgtcacctgaccaggaccctgggcagctgtttccgatggtgctgctggtcttcttgctg
O70337_BIK-02      gtgtcacctgaccaggaccctgggcagctgtttccgatggtgctgctggtcttcttgctg
O70337_BIK-03      gtgtcacctgaccaggaccctgggcagctgtttccgatggtgctgctggtcttcttgctg
                   ************************************************************

O70337_BIK-04      ctgggtggggcctggtatttgcagcttcagtga
O70337_BIK-01      ctgggtggggcctggtatttgcagcttcagtga
O70337_BIK-02      ctgggtggggcctggtatttgcagcttcagtga
O70337_BIK-03      ctgggtggg------------------------
                   *********                        

© 1998-2018