Dataset for CDS BAD of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q61337_BAD-02      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
Q61337_BAD-03      ------------------------------------------------------------
Q61337_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
                                                                               

Q61337_BAD-02      gatcccggaatccggagcctggggagcgacgcgggaggaaggcggtggagaccagcagcc
Q61337_BAD-03      ------------------------------------------------------------
Q61337_BAD-01      gatcccggaatccggagcctggggagcgacgcgggaggaaggcggtggagaccagcagcc
                                                                               

Q61337_BAD-02      cagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-03      ------atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-01      cagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
                         ******************************************************

Q61337_BAD-02      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-03      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-01      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
                   ************************************************************

Q61337_BAD-02      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-03      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-01      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
                   ************************************************************

Q61337_BAD-02      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-03      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-01      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
                   ************************************************************

Q61337_BAD-02      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-03      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-01      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
                   ************************************************************

Q61337_BAD-02      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-03      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-01      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
                   ************************************************************

Q61337_BAD-02      tccttcaaggga-----------gaagagc------------------------------
Q61337_BAD-03      tccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagc
Q61337_BAD-01      tccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagc
                   ************            ******                              

Q61337_BAD-02      -------tgacgtaca---------------------------------------gcttg
Q61337_BAD-03      gccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctcc
Q61337_BAD-01      gccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctcc
                           ****  **                                       ***  

Q61337_BAD-02      agtcccttccggtgcgtgcaatag
Q61337_BAD-03      accccctcccagtga---------
Q61337_BAD-01      accccctcccagtga---------
                   *  **** ** ***          

© 1998-2018