Dataset for CDS classical BH3-containing proteins of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         gttaggttgggggaggctccggggaagcccctctcgccaggttgcggcag
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         cggccagcggggtccgggcggggcggggtcgggcggggcggggcggggcg
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         gtgggagccgcagcaggcgccgcagcctcagcagcccggcgctggcaagt
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         cccaactgcctcggcgcagacggctgcaggagggcgggagcggggggcgg
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         gagcggggcggggcggtcggtgacgtcacgcgggagccggggcgcgcggc
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         tgcagcgcgaggcggcggcggcggcggccgcggcagaaccagcctgggag
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         ccggcggcgcaagacacatgcgtgcggcccgcgggagccacagcaggagc
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         gggagcgggagcagtggcgagcggcggcggcgacagaggtggcggcagca
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         gcagcagcagcagcagcagcagcagcagcagcagcagcagaggcagcagc
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         agaggcagcggtggagagcaggcagcgcggagccaggcgcccccgggccg
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         gcccggaccccgcctgacagcccctcaggcccgcccccgaaggcgcgttc
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         atgcccccggggggctcggcgtgggcctccgcagtggtgagtgtgcgccg
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         cggctgggggtgcgcgtgccgtgccgtgagcgggggccgctgtcaccgcg
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         ctgctgctgccgctgtgagtgcggggccggactggggaaactgaggcggg
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         gccgggcccgaggggtggcaccgccgctcacctgctccgcccacctgtct
K7E5Y2_BBC3-02         --------------------------------------------------

F7CXT2_BCL2L11-01      ---------------------------------atggcaaaacaaccgtc
F6X3N6_BMF-01          ---------------------------------atg--------------
F7G1G0_HRK-01          ---------------------------------atg--------------
K7E5Y2_BBC3-01         gtgtccctccgcaggctccctccccactggggcatggccagagcccagca
K7E5Y2_BBC3-02         ---------------------------------atggccagagcccagca

F7CXT2_BCL2L11-01      agatctaaattctgagtgtgacagagaaggtggacaattgcagcctacag
F6X3N6_BMF-01          -------gagcct-------cctcactatgtggaaga--gcta-------
F7G1G0_HRK-01          --------------------------------------------------
K7E5Y2_BBC3-01         ggatggcagctct-------ccggagccggtggaggg--gctgccccggg
K7E5Y2_BBC3-02         ggatggcagctct-------ccggagccggtggaggg--gctgccccggg

F7CXT2_BCL2L11-01      aaaggcctactcagcctcaacaactcagaccaggggcccctacctctata
F6X3N6_BMF-01          ---------------------gaggacgatgtgttccacccg--------
F7G1G0_HRK-01          ---------------------------tgcccgtgtcccctg--------
K7E5Y2_BBC3-01         agagccccaggaccttccccctgggccggctcatgccctctg--------
K7E5Y2_BBC3-02         agagccccaggaccttccccctgggccggctcatgccctctg--------
                                                           *  *          

F7CXT2_BCL2L11-01      caaacacagtatcaaggtaattcaggtgaaggggacagctgctcacccag
F6X3N6_BMF-01          ----------------------gaggactcagagcctggtgctcagccag
F7G1G0_HRK-01          ----------------------ca-----ccgcggtcgcggt--------
K7E5Y2_BBC3-01         ----------------------cggtctcctgcagcctctgtgaggccgg
K7E5Y2_BBC3-02         ----------------------cggtctcctgcagcctctgtgaggccgg
                                                      *        *         

F7CXT2_BCL2L11-01      cag-----tcctcagggaccgtttgcaccacccactagccctagt----c
F6X3N6_BMF-01          ggggcctgacctcagctgctctgtttgccca------gagccagcctgac
F7G1G0_HRK-01          --------cccccggcgg---tgtgcgcctg----------cagc-----
K7E5Y2_BBC3-01         cttgaacccctctggcgactccatgtgcccagccccggggccagc-----
K7E5Y2_BBC3-02         cttgaacccctctggcgactccatgtgcccagccccggggccagc-----
                                *    *        *   **             **      

F7CXT2_BCL2L11-01      catttgctaccagatccccacttttcatctttttaagaagatctccactg
F6X3N6_BMF-01          tatatgctggatgggctgcagcttttccctctt------actcactgctg
F7G1G0_HRK-01          -----tcggac---------------------c------gcctggaacag
K7E5Y2_BBC3-01         -----gctggcaccctcttccctcctgcccctc------gcttacttctg
K7E5Y2_BBC3-02         -----gctggcaccctcttccctcctgcccctc------gcttacttctg
                             *                                        * *

F7CXT2_BCL2L11-01      ctgcctcgatcttc---cagtgggtatttctcttttgacacagac----a
F6X3N6_BMF-01          tggcccagggcttcggtcagttgg-----ccaggaagataaggccactca
F7G1G0_HRK-01          cgcgcggc----------------------------------ggcggc--
K7E5Y2_BBC3-01         cacgcgacagccccgtgcctatgggggcccccgctgggcacgggcggcca
K7E5Y2_BBC3-02         cacgcgacagccccgtgcctatgggggcccccgctgggcacgggcggcca
                           *                                     * *     

F7CXT2_BCL2L11-01      ggagtccagc---------------gcctatgagttgtgataaatctac-
F6X3N6_BMF-01          gactctcagt--ccagcatcccccagccaaggtgtcatgctgcctt----
F7G1G0_HRK-01          --agcacagctcacggccgcccgc-ctcaaggcgctt-------------
K7E5Y2_BBC3-01         ggagcccggcggccggcaaccagg-gccaaagcggttccctgccctccct
K7E5Y2_BBC3-02         ggagcccggcggccggcaaccagg-gccaaagcggttccctgccctccct
                             * *                  * * * *                

F7CXT2_BCL2L11-01      --------------------------------------acaaactcca--
F6X3N6_BMF-01          --------------------------gtggagtgactgaagagccccacc
F7G1G0_HRK-01          --------------------------ggggac--------gagctgca--
K7E5Y2_BBC3-01         gggccccaggtctgcccaggaggaggggggacaggagggagagcccca--
K7E5Y2_BBC3-02         gggccccaggtctgcccaggaggaggggggacaggagggagagcccca--
                                                                * *  **  

F7CXT2_BCL2L11-01      --------------------------agccctccttgtcaagccttcaat
F6X3N6_BMF-01          gactcttttatggcaatgctggatatcgacttcccctcccagc---cagt
F7G1G0_HRK-01          ---------------------ggaacgg---accatgt------------
K7E5Y2_BBC3-01         ---------------------gggagcgtcccccatgtctggc-----gg
K7E5Y2_BBC3-02         ---------------------gggagcgtcccccatgtctggc-----gg
                                                  *    **                

F7CXT2_BCL2L11-01      cattatctaagtgcaatggcttccatgaggcagtctca-------atcaa
F6X3N6_BMF-01          tttcctgctagcctgc-ggcttggag-aggagccccctgaagagcagtgg
F7G1G0_HRK-01          ------ggaggcgccg-ggcgcggag------------------------
K7E5Y2_BBC3-01         ccccccgggggtgtta-ggcccggagcacggggaccaaggcgagcagcag
K7E5Y2_BBC3-02         ccccccgggggtgtta-ggcccggagcacggggaccaaggcgagcagcag
                                 *      ***    *                         

F7CXT2_BCL2L11-01      tacctgcagatatgcggccagaaatttggattgcacaagaattgcgccgt
F6X3N6_BMF-01          ga--------gcatcgagccgaggtgcagattgcccaaaagcttcaatgc
F7G1G0_HRK-01          ----------tcggcgggccgcagcggagg-cggccg-------------
K7E5Y2_BBC3-01         gaccgggagatcggcgcccagctgcgcaggatggccgatgacctcaacgc
K7E5Y2_BBC3-02         gaccgggagatcggcgcccagctgcgcaggatggccgatgacctcaacgc
                                     **  * *       *   *  *              

F7CXT2_BCL2L11-01      attggagatgaatttaatgcttcctattatccaagaagggggtttttgga
F6X3N6_BMF-01          atagcggaccagttccatagactcca-----catgcagcgg---------
F7G1G0_HRK-01          ----------------------------------gcagcgg---------
K7E5Y2_BBC3-01         --------------------cctgta-----cgagcagcgg---------
K7E5Y2_BBC3-02         --------------------cctgta-----cgagcagcgg---------
                                                         * ** **         

F7CXT2_BCL2L11-01      taataactatca-----aggagcaggtgaccatcaccaaatggttatttt
F6X3N6_BMF-01          -------cacca---------gcag--aaccgaaaccatgtgtggtggca
F7G1G0_HRK-01          -------cggcg---------gcgg--gctcc---ccgccta-----ctg
K7E5Y2_BBC3-01         -------agacgggaggaggagcag--aggcg---ccacctgtcgccctg
K7E5Y2_BBC3-02         -------agacgggaggaggagcag--aggcg---ccacctgtcgccctg
                                 *          ** *     *    **   *         

F7CXT2_BCL2L11-01      acgcctgttacgttacatcatcc-----------gccttgtttggagaat
F6X3N6_BMF-01          aatcctcctcttccttcacaact---------tggccttgaacagagagg
F7G1G0_HRK-01          ggcttggctgtgcg------------------cggccgctcatgtggcgg
K7E5Y2_BBC3-01         gaggctgctgtacaatctcatctcggggctcctggcccccca-gcgaagg
K7E5Y2_BBC3-02         gaggctgctgtacaatctcatctcggggctcctggcccccca-gcgaagg
                               *                         ***             

F7CXT2_BCL2L11-01      ----------------------gcag--------tga
F6X3N6_BMF-01          agaacaggaatggg--------gcaggccctaggtga
F7G1G0_HRK-01          cgctggcggcctggctgctccggaggag--aaacttg
K7E5Y2_BBC3-01         aaccggatgccggac-------gtggagcccaactag
K7E5Y2_BBC3-02         aaccggatgccggac-------gtggagcccaactag
                                             *  *        *  

© 1998-2019