Dataset for CDS BBC3 of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


K7E5Y2_BBC3-01      gttaggttgggggaggctccggggaagcccctctcgccaggttgcggcagcggccagcgg
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      ggtccgggcggggcggggtcgggcggggcggggcggggcggtgggagccgcagcaggcgc
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      cgcagcctcagcagcccggcgctggcaagtcccaactgcctcggcgcagacggctgcagg
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      agggcgggagcggggggcgggagcggggcggggcggtcggtgacgtcacgcgggagccgg
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      ggcgcgcggctgcagcgcgaggcggcggcggcggcggccgcggcagaaccagcctgggag
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      ccggcggcgcaagacacatgcgtgcggcccgcgggagccacagcaggagcgggagcggga
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      gcagtggcgagcggcggcggcgacagaggtggcggcagcagcagcagcagcagcagcagc
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      agcagcagcagcagcagcagaggcagcagcagaggcagcggtggagagcaggcagcgcgg
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      agccaggcgcccccgggccggcccggaccccgcctgacagcccctcaggcccgcccccga
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      aggcgcgttcatgcccccggggggctcggcgtgggcctccgcagtggtgagtgtgcgccg
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      cggctgggggtgcgcgtgccgtgccgtgagcgggggccgctgtcaccgcgctgctgctgc
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      cgctgtgagtgcggggccggactggggaaactgaggcggggccgggcccgaggggtggca
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      ccgccgctcacctgctccgcccacctgtctgtgtccctccgcaggctccctccccactgg
K7E5Y2_BBC3-02      ------------------------------------------------------------
                                                                                

K7E5Y2_BBC3-01      ggcatggccagagcccagcaggatggcagctctccggagccggtggaggggctgccccgg
K7E5Y2_BBC3-02      ---atggccagagcccagcaggatggcagctctccggagccggtggaggggctgccccgg
                       *********************************************************

K7E5Y2_BBC3-01      gagagccccaggaccttccccctgggccggctcatgccctctgcggtctcctgcagcctc
K7E5Y2_BBC3-02      gagagccccaggaccttccccctgggccggctcatgccctctgcggtctcctgcagcctc
                    ************************************************************

K7E5Y2_BBC3-01      tgtgaggccggcttgaacccctctggcgactccatgtgcccagccccggggccagcgctg
K7E5Y2_BBC3-02      tgtgaggccggcttgaacccctctggcgactccatgtgcccagccccggggccagcgctg
                    ************************************************************

K7E5Y2_BBC3-01      gcaccctcttccctcctgcccctcgcttacttctgcacgcgacagccccgtgcctatggg
K7E5Y2_BBC3-02      gcaccctcttccctcctgcccctcgcttacttctgcacgcgacagccccgtgcctatggg
                    ************************************************************

K7E5Y2_BBC3-01      ggcccccgctgggcacgggcggccaggagcccggcggccggcaaccagggccaaagcggt
K7E5Y2_BBC3-02      ggcccccgctgggcacgggcggccaggagcccggcggccggcaaccagggccaaagcggt
                    ************************************************************

K7E5Y2_BBC3-01      tccctgccctccctgggccccaggtctgcccaggaggaggggggacaggagggagagccc
K7E5Y2_BBC3-02      tccctgccctccctgggccccaggtctgcccaggaggaggggggacaggagggagagccc
                    ************************************************************

K7E5Y2_BBC3-01      cagggagcgtcccccatgtctggcggccccccgggggtgttaggcccggagcacggggac
K7E5Y2_BBC3-02      cagggagcgtcccccatgtctggcggccccccgggggtgttaggcccggagcacggggac
                    ************************************************************

K7E5Y2_BBC3-01      caaggcgagcagcaggaccgggagatcggcgcccagctgcgcaggatggccgatgacctc
K7E5Y2_BBC3-02      caaggcgagcagcaggaccgggagatcggcgcccagctgcgcaggatggccgatgacctc
                    ************************************************************

K7E5Y2_BBC3-01      aacgccctgtacgagcagcggagacgggaggaggagcagaggcgccacctgtcgccctgg
K7E5Y2_BBC3-02      aacgccctgtacgagcagcggagacgggaggaggagcagaggcgccacctgtcgccctgg
                    ************************************************************

K7E5Y2_BBC3-01      aggctgctgtacaatctcatctcggggctcctggccccccagcgaaggaaccggatgccg
K7E5Y2_BBC3-02      aggctgctgtacaatctcatctcggggctcctggccccccagcgaaggaaccggatgccg
                    ************************************************************

K7E5Y2_BBC3-01      gacgtggagcccaactag
K7E5Y2_BBC3-02      gacgtggagcccaactag
                    ******************

© 1998-2018