Dataset for CDS classical BH3-containing proteins of organism Mola mola

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3VLX6_BMF-01      atgg-----------acgatgacgaggatgatgtatttgagccagaggcc
A0A3Q3WTY4_BAD-01      atggctaccaatttcaccatttcaag-----tgacagcgagtcagag---
                       ****           ** **  * **     **     *** *****   

A0A3Q3VLX6_BMF-01      cactgctggcgcaccacattccgggagataaagtgtgaagaccggggcac
A0A3Q3WTY4_BAD-01      --ctgtcag-------------aggaaatagaagaaggaga---------
                         ***   *              *** *** *    * ***         

A0A3Q3VLX6_BMF-01      gcagacacctggccctgccctg-gcaccatacagcggcatgcttccttgt
A0A3Q3WTY4_BAD-01      --aaacagtcagctacaaactgagca----agagcagcaggtttttcaac
                         * ***    **      *** ***    * *** *** * **      

A0A3Q3VLX6_BMF-01      ggagtcgcagaggaacccagacacctcttctacgtgacctcatccctggc
A0A3Q3WTY4_BAD-01      g---------------tcacaccctcaccctacctgagctca--------
                       *                ** ** *     **** *** ****        

A0A3Q3VLX6_BMF-01      gcctgatagtcgtgataactgtag-----ggagcgaaacgg---------
A0A3Q3WTY4_BAD-01      ggatggcaggtaggac-actgcaggttaagggggaagacgaggctgggac
                       *  **  **    **  **** **     ** *  * ***          

A0A3Q3VLX6_BMF-01      -------gatggagcggcttccacggcagcag-------cctgtggctca
A0A3Q3WTY4_BAD-01      gcccaccgatggagctccgttcaggg--gcaggtccaaatctgctccccc
                              ********  * * ** **  ****        ***   * * 

A0A3Q3VLX6_BMF-01      cagtgtggaggcctgca------tcggccagaagctccagctgataggag
A0A3Q3WTY4_BAD-01      ttctttgtgggcagccaagaaatatggacagaggctccgaaggatgagcg
                          * **  ***   **        ** **** *****    ***  * *

A0A3Q3VLX6_BMF-01      accagtttcaccgggaacacatgcaa-----------ctgtatcatcgaa
A0A3Q3WTY4_BAD-01      atgaatttgacaggcaaga-atggaagacgaggagtgctgggacggccac
                       *  * *** ** ** ** * *** **           ***   *  * * 

A0A3Q3VLX6_BMF-01      accaaaggaaccaggggccgctctggtggcgcttgggttcagctctgctc
A0A3Q3WTY4_BAD-01      a-cagatgcaccagtctcgaagctggtggagct-----------------
                       * ** * * *****   *    ******* ***                 

A0A3Q3VLX6_BMF-01      agccttctgtttgacagggggttctttgctggaggaggtgg---------
A0A3Q3WTY4_BAD-01      acctctttagtcaccaggaga----cggacggagagaacaaccatcatga
                       * *  * *  *   **** *       *  ****                

A0A3Q3VLX6_BMF-01      -agcgggacgga--------ggtga
A0A3Q3WTY4_BAD-01      tagccacacgcatcgtaatgagtag
                        ***   *** *         **  

© 1998-2019