Dataset for CDS BMF of organism Mesocricetus auratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U8CPE0_BMF-02      attttcccaggagagatggagccacctcagtgtgtggaggagctggaaga
A0A1U8CPE0_BMF-01      ---------------atggagccacctcagtgtgtggaggagctggaaga
                                      ***********************************

A0A1U8CPE0_BMF-02      tgatgtgttccagtcagaggatggggagccagggacacaacctgggagct
A0A1U8CPE0_BMF-01      tgatgtgttccagtcagaggatggggagccagggacacaacctgggagct
                       **************************************************

A0A1U8CPE0_BMF-02      tgctctctgctgacccgtttgcccagagccagctggattgtcccctcagc
A0A1U8CPE0_BMF-01      tgctctctgctgacccgtttgcccagagccagctggattgtcccctcagc
                       **************************************************

A0A1U8CPE0_BMF-02      cggcttcagctcttccctctcactcactgctgtggtcctgggctccggcc
A0A1U8CPE0_BMF-01      cggcttcagctcttccctctcactcactgctgtggtcctgggctccggcc
                       **************************************************

A0A1U8CPE0_BMF-02      cataagccaggaagacaaggccacccagaccctcagcccagcctccccaa
A0A1U8CPE0_BMF-01      cataagccaggaagacaaggccacccagaccctcagcccagcctccccaa
                       **************************************************

A0A1U8CPE0_BMF-02      gccagggtgttatgctgccttgtggggtgacagaggaaccccagagactc
A0A1U8CPE0_BMF-01      gccagggtgttatgctgccttgtggggtgacagaggaaccccagagactc
                       **************************************************

A0A1U8CPE0_BMF-02      ttttacggcaatgctggctacaggcttcctctccctgccagtttccccgc
A0A1U8CPE0_BMF-01      ttttacggcaatgctggctacaggcttcctctccctgccagtttccccgc
                       **************************************************

A0A1U8CPE0_BMF-02      aggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgag
A0A1U8CPE0_BMF-01      aggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgag
                       **************************************************

A0A1U8CPE0_BMF-02      cagaggtacagatcgccagaaagcttcagtgtattgctgaccagttccat
A0A1U8CPE0_BMF-01      cagaggtacagatcgccagaaagcttcagtgtattgctgaccagttccat
                       **************************************************

A0A1U8CPE0_BMF-02      cggctgcacatacaacaacaccagcagaaccgagaccgtgcatggtggca
A0A1U8CPE0_BMF-01      cggctgcacatacaacaacaccagcagaaccgagaccgtgcatggtggca
                       **************************************************

A0A1U8CPE0_BMF-02      ggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacaggg
A0A1U8CPE0_BMF-01      ggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacaggg
                       **************************************************

A0A1U8CPE0_BMF-02      aaggggtgggtccctggtga
A0A1U8CPE0_BMF-01      aaggggtgggtccctggtga
                       ********************

© 1998-2018