Dataset for CDS BCL2L11 of organism Mesocricetus auratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U8BW10_BCL2L11      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
A0A1U8BW10_BCL2L11      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
A0A1U8BW10_BCL2L11      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A1U8BW10_BCL2L11      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
A0A1U8BW10_BCL2L11      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
A0A1U8BW10_BCL2L11      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
                        **************************************************

A0A1U8BW10_BCL2L11      cctccctacagacagaacagca----------------------------
A0A1U8BW10_BCL2L11      cctccctacagacagaacagcaaggtaatcctgacggtgaaggggaccgc
A0A1U8BW10_BCL2L11      cctccctacagacagaacagca----------------------------
                        **********************                            

A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      tgcccccacggcagcccgcagggcccgctggccccaccggccagccctgg
A0A1U8BW10_BCL2L11      --------------------------------------------------
                                                                          

A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      cccttctgctaccagatccccacttttcatctttgtgagaagatcttctc
A0A1U8BW10_BCL2L11      --------------------------------------------------
                                                                          

A0A1U8BW10_BCL2L11      ----------------------------------------agacaggagt
A0A1U8BW10_BCL2L11      tgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagt
A0A1U8BW10_BCL2L11      ----------------------------------------agacaggagt
                                                                **********

A0A1U8BW10_BCL2L11      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
A0A1U8BW10_BCL2L11      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
A0A1U8BW10_BCL2L11      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
                        **************************************************

A0A1U8BW10_BCL2L11      ccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctc
A0A1U8BW10_BCL2L11      ccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctc
A0A1U8BW10_BCL2L11      ccaagccttcaaccattatctcagtgcaatgga-tctgtgtgagaatctt
                        ********************************  **  *  *  * *** 

A0A1U8BW10_BCL2L11      aggaggaacctgcagatatccgcccggagatatggattgcacaggagctt
A0A1U8BW10_BCL2L11      aggaggaacctgcagatatccgcccggagatatggattgcacaggagctt
A0A1U8BW10_BCL2L11      aag--------------------------------------cacgag---
                        * *                                      ** ***   

A0A1U8BW10_BCL2L11      cggcggattggagacgagttcaacgaatcttacagaaggagggtaaataa
A0A1U8BW10_BCL2L11      cggcggattggagacgagttcaacgaatcttacagaaggagggtaaataa
A0A1U8BW10_BCL2L11      tggcagattcatggtga--tcaa------------------agtaaa---
                         *** ****   *  **  ****                   *****   

A0A1U8BW10_BCL2L11      ttaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttac
A0A1U8BW10_BCL2L11      ttaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttac
A0A1U8BW10_BCL2L11      --------------------------------------------------
                                                                          

A0A1U8BW10_BCL2L11      aactgttacgcttcatcgtccgactagtatggagaaggcattga
A0A1U8BW10_BCL2L11      aactgttacgcttcatcgtccgactagtatggagaaggcattga
A0A1U8BW10_BCL2L11      -------------------------agt----------------
                                                 ***                

© 1998-2018