Dataset for CDS classical BH3-containing proteins of organism Meleagris gallopavo

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1MV54_BCL2L11-01      tttttgctctgtgcagcttccagg--------------------------
G1NHG8_BMF-01          --atggatcgccccagctacctggaagaggactattctagcctggatggg
                          * * **    ***** ** **                          

G1MV54_BCL2L11-01      --------tggcg-atctcactc------------acttgcag-------
G1NHG8_BMF-01          ctggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcc
                               ** **  * ******            ********       

G1MV54_BCL2L11-01      ------aagaaatacaaccagaaatatggattgcacagga----------
G1NHG8_BMF-01          tggtgagatgactgcaactggcatt----ttcacacagaaccagtcctac
                              *  * * ****  * * *     *  ***** *          

G1MV54_BCL2L11-01      -------------------------------------------gctgcgg
G1NHG8_BMF-01          agctgccttctggggaggtttcaactatttcccctcacacactgctgtgg
                                                                  **** **

G1MV54_BCL2L11-01      c----gcatcggggat-------------------gaattcaa-------
G1NHG8_BMF-01          tcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacactca
                            *  ** ** **                    ** ****       

G1MV54_BCL2L11-01      ------------------------------tgcctcctattgtccaagaa
G1NHG8_BMF-01          gcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaa
                                                     *****  *   ***   ***

G1MV54_BCL2L11-01      -------ggggtttcttggataaccatgctggaaa-------------cc
G1NHG8_BMF-01          gagccccggagactcttctatgggaatgctggttaccgcttacatgtccc
                              ** *  ****  **    *******  *             **

G1MV54_BCL2L11-01      cccaggtggtcat--------tctgcgcctcc------------------
G1NHG8_BMF-01          cccagttggctttgcattggatccaaatctccaagaagagcctcaggaag
                       ***** ***   *        **     ****                  

G1MV54_BCL2L11-01      -----------------------------------------------tgc
G1NHG8_BMF-01          gtcagcgggaggcgcgtactgaggtgcagattgcacggaagttgcagtgc

G1MV54_BCL2L11-01      attaca-------tcatccgcctc--------------------------
G1NHG8_BMF-01          attgcagaccagttccaccggctccacatacagcggcatcagcagaacag
                       *** **       **  *** ***                          

G1MV54_BCL2L11-01      --------------------------------------------------
G1NHG8_BMF-01          aaatcaagtgtggtggcagctttttctctttctacacaacttggccttaa

G1MV54_BCL2L11-01      atctggagg-----------------atgca---gtga
G1NHG8_BMF-01          atgtggaggcgaacaggaaccgcactgggcagaggtga
                       ** ******                   ***   ****

© 1998-2019