Dataset for CDS classical BH3-containing proteins of organism Maylandia zebra

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9B2E4_BAD-01      atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagagga
A0A3P9DPJ5_BMF-02      atggacga-----tgagga----ggacgatgtgtttgagcca--------
A0A3P9DPJ5_BMF-01      atggacga-----tgagga----ggacgatgtgtttgagcca--------
                       ****  *      * *  *     ***  **  *  *** **        

A0A3P9B2E4_BAD-01      ggtaggggaaggagaaaaccaacagtcagcaggacaagctcaagaaagca
A0A3P9DPJ5_BMF-02      --------------aaagccaactgttggcgcaccacattcagggagata
A0A3P9DPJ5_BMF-01      --------------aaagccaactgttggcgcaccacattcagggagata
                                     *** ***** **  **    **   *** * *   *

A0A3P9B2E4_BAD-01      ag----------------ccccagacgctt--tcccttcctgtaaccaaa
A0A3P9DPJ5_BMF-02      aagtgtgaacatcgaggcacacagacacccggtcctgccctggtacc-aa
A0A3P9DPJ5_BMF-01      aagtgtgaacatcgaggcacacagacacccggtcctgccctggtacc-aa
                       *                  * ***** *    ***   ****  *** **

A0A3P9B2E4_BAD-01      acgacagc-tgctg------gaaggctcagggtgaactcagagtcccaca
A0A3P9DPJ5_BMF-02      acaacggcatgctgccctgtggagtcgcagag-gagcccaga---ccact
A0A3P9DPJ5_BMF-01      acaacggcatgctgccctgtggagtcgcagag-gagcccaga---ccact
                       ** ** ** *****      * ** * *** * ** * ****   **** 

A0A3P9B2E4_BAD-01      cttc----------------ctcaattgc---------------------
A0A3P9DPJ5_BMF-02      cttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagc
A0A3P9DPJ5_BMF-01      cttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagc
                       ****                 ** *****                     

A0A3P9B2E4_BAD-01      ----cagggatga-----------------ggagctcatggctagagggg
A0A3P9DPJ5_BMF-02      tcgtcggggatcacagagcgagtcgacaaggaagcacggagcagcaaaac
A0A3P9DPJ5_BMF-01      tcgtcggggatcacagagcgagtcgacaaggaagcacggagcagcaaaac
                           * ***** *                 * *** *   **   *    

A0A3P9B2E4_BAD-01      aggatgaggtctgtactcccacagag------------------ggagac
A0A3P9DPJ5_BMF-02      agcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggc
A0A3P9DPJ5_BMF-01      agcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggc
                       ** ***  *    * * **  *** *                  **** *

A0A3P9B2E4_BAD-01      c--cattcaggcgaaggtcaaagtca----gctccccctgctctgtgggc
A0A3P9DPJ5_BMF-02      ctgcattggacagaaactccagctcataggagaccagtttcactg-ggaa
A0A3P9DPJ5_BMF-01      ctgcattggacagaaactccagctcataggagaccagtttcactg-ggaa
                       *  ****     ***  ** *  ***       **   * * *** **  

A0A3P9B2E4_BAD-01      tgccaagaagtacggcaggcagcttcgacgaatgagtgacgagtttgaca
A0A3P9DPJ5_BMF-02      cgcctgcaactgtatcaccgaaaccaaaggaaccaggggccgatgtggtg
A0A3P9DPJ5_BMF-01      cgcctgcaactgtatcaccgaaaccaaaggaaccaggggccgatgtggtg
                        ***   ** *    **   *      * ***  ** * *   * **   

A0A3P9B2E4_BAD-01      gc--------------------------ttactagataaaggggtaagaa
A0A3P9DPJ5_BMF-02      gcgcctggccgcggccattctcagccttctgtttgatagggggttcatag
A0A3P9DPJ5_BMF-01      gcgcctggccgcggccattctcagccttctgtttgatagggggttcatag
                       **                           *  * ****  *** * * * 

A0A3P9B2E4_BAD-01      t---gggagtgagtcaaggcttaaattag
A0A3P9DPJ5_BMF-02      ccggaggagggggtggaggacggaggtga
A0A3P9DPJ5_BMF-01      ccggaggagggggtggaggacggaggtga
                            **** * **  ***    *  *  

© 1998-2019