Dataset for CDS BAD of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3RXS8_BAD-02      atggctgcaaaattcagtatttcagaaagcgaatcagactcatcagagga
A0A3Q3RXS8_BAD-01      atggctgcaaaattcagtatttcagaaagcgaatcagactcatcagagga
                       **************************************************

A0A3Q3RXS8_BAD-02      ggtagagggaggaaaacagaagaagtcgtcagcaaggcaagagcaacagg
A0A3Q3RXS8_BAD-01      ggtagagggaggaaaacagaagaagtcgtcagcaaggcaagagcaacagg
                       **************************************************

A0A3Q3RXS8_BAD-02      tttctcagcgccacgcccttgccttacctgagctcagaacaacagcctcc
A0A3Q3RXS8_BAD-01      tttctcagcgccacgcccttgccttacctgagctcagaacaacagcctcc
                       **************************************************

A0A3Q3RXS8_BAD-02      aatcgaatcaggctgagttcggagtcccagtccagggtggatgaggaggc
A0A3Q3RXS8_BAD-01      aatcgaatcaggctgagttcggagtcccagtccagggtggatgaggaggc
                       **************************************************

A0A3Q3RXS8_BAD-02      tggtacgcccacagacggagctccatttaggggaaggtccaagtcagctc
A0A3Q3RXS8_BAD-01      tggtacgcccacagacggagctccatttaggggaaggtccaagtcagctc
                       **************************************************

A0A3Q3RXS8_BAD-02      cccctgctctgtgggcagccaagaaatatggccagcagctccgaaggatg
A0A3Q3RXS8_BAD-01      cccctgctctgtgggcagccaagaaatatggccagcagctccgaaggatg
                       **************************************************

A0A3Q3RXS8_BAD-02      agcgatgagtttgacagcctcctggataaaggggaaatgagagtgaggaa
A0A3Q3RXS8_BAD-01      agcgatgagtttgacagcctcctggataaaggggaaatgagagtgaggaa
                       **************************************************

A0A3Q3RXS8_BAD-02      tgctggcaaggcccaaaagatgcaccactctaaaacctggtggagctacc
A0A3Q3RXS8_BAD-01      tgctggcaaggcccaaaagatgcaccactctaaaacctggtggagctacc
                       **************************************************

A0A3Q3RXS8_BAD-02      tctttagttaccaggagacagatggagaaaacaacctccatgaaaaccac
A0A3Q3RXS8_BAD-01      tctttagttaccaggagacagatggagaaaacaacctccatgaaaaccac
                       **************************************************

A0A3Q3RXS8_BAD-02      acaccccgcacagagtag
A0A3Q3RXS8_BAD-01      acaccccgcacagagtag
                       ******************

© 1998-2019