Dataset for CDS classical BH3-containing proteins of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

18 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5ZWH1_PMAIP1-      atgcc---------------------------------------------
A0A2K5ZWH1_PMAIP1-      atgcc---------------------------------------------
A0A2K5XSA1_BIK-01       atgtctggagtaagacccatctccagagacaccttgatggagaccctcct
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z8B6_BCL2L11      atggc-------aaagcaaccttctga-----------------------
A0A2K5Z4C3_BMF-01       atgg-----------------agcc-a-----------------------
A0A2K5Z4C3_BMF-02       atgg-----------------agcc-a-----------------------
A0A2K5XJR2_BAD-02       atgt-----------------tccaga-----------------------
A0A2K5XJR2_BAD-01       atgt-----------------tccaga-----------------------
A0A2K5XJR2_BAD-03       atgt-----------------tccaga-----------------------

A0A2K5ZWH1_PMAIP1-      -----------------------------t--------------------
A0A2K5ZWH1_PMAIP1-      -----------------------------t--------------------
A0A2K5XSA1_BIK-01       gtatgagcagctcctggaacccctaaccatggaggttcttggtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z8B6_BCL2L11      -----------------------------tgtaagttctgagtgtg----
A0A2K5Z4C3_BMF-01       -----------------------------t-----ctcggtgtgtg----
A0A2K5Z4C3_BMF-02       -----------------------------t-----ctcggtgtgtg----
A0A2K5XJR2_BAD-02       -----------------------------t-----cccagagtttgagcc
A0A2K5XJR2_BAD-01       -----------------------------t-----cccagagtttgagcc
A0A2K5XJR2_BAD-03       -----------------------------t-----cccagagtttgagcc

A0A2K5ZWH1_PMAIP1-      -gggaagaaggcgcgcaagaacgcgcaacc--------------------
A0A2K5ZWH1_PMAIP1-      -gggaagaaggcgcgcaagaacgcgcaacc--------------------
A0A2K5XSA1_BIK-01       -actgaccctgaagagga----cctggaccctatggaggacttcgatcct
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z8B6_BCL2L11      -accgagaaggtagacaa----ttgcagc-ctgcgga-------------
A0A2K5Z4C3_BMF-01       -gaggagctggaggatgatgtgttccagccggaggac-------------
A0A2K5Z4C3_BMF-02       -gaggagctggaggatgatgtgttccagccggaggac-------------
A0A2K5XJR2_BAD-02       tagtgagcaggaaga-------ctccagctctgcaga-------------
A0A2K5XJR2_BAD-01       tagtgagcaggaaga-------ctccagctctgcaga-------------
A0A2K5XJR2_BAD-03       tagtgagcaggaaga-------ctccagctctgcaga-------------
                             *    *                 *                     

A0A2K5ZWH1_PMAIP1-      ------------gag------------------------cccaacgcggg
A0A2K5ZWH1_PMAIP1-      ------------gag------------------------cccaacgcggg
A0A2K5XSA1_BIK-01       ttggagtgtatggaggacagtgacatgttggccctgcggctggcctgcat
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z8B6_BCL2L11      ------------gaggcctccccagctcagacctggggcccctacctccc
A0A2K5Z4C3_BMF-01       ------------ggg--------------gagccgggggcccaaccc---
A0A2K5Z4C3_BMF-02       ------------ggg--------------gagccgggggcccaaccc---
A0A2K5XJR2_BAD-02       ------------gag--------------gggcctgggccccagcctcgc
A0A2K5XJR2_BAD-01       ------------gag--------------gggcctgggccccagcctcgc
A0A2K5XJR2_BAD-03       ------------gag--------------gggcctgggccccagcctcgc
                                    * *                        *    *     

A0A2K5ZWH1_PMAIP1-      ctcaggcaggacaggcagggacggcagg----------------------
A0A2K5ZWH1_PMAIP1-      ctcaggcag-----------------------------------------
A0A2K5XSA1_BIK-01       cggggacgagatggatgtgagcctcagg----------------------
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaag----------------------
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaag----------------------
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaag----------------------
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaaggtaatcccgaaggcaatcacgg
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaaggtaatcccgaaggcaatcacgg
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaaggtaatcccgaaggcaatcacgg
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccaca------------------------
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaaggtaatcccgaaggcaatcacgg
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaaggtaatcccgaaggcaatcacgg
A0A2K5Z8B6_BCL2L11      tacagaca----------gagccacaaggtaatcccgaaggcaatcacgg
A0A2K5Z4C3_BMF-01       -gggagct----------cgctctctgc----------------------
A0A2K5Z4C3_BMF-02       -gggagct----------cgctctctgc----------------------
A0A2K5XJR2_BAD-02       gggggaca----------ggccctcaga----------------------
A0A2K5XJR2_BAD-01       gggggaca----------ggccctcaga----------------------
A0A2K5XJR2_BAD-03       gggggaca----------ggccctcaga----------------------

A0A2K5ZWH1_PMAIP1-      ------------------------------------------------ga
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       -------------------------------------------------g
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
A0A2K5Z8B6_BCL2L11      aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
A0A2K5Z8B6_BCL2L11      aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
A0A2K5Z8B6_BCL2L11      aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
A0A2K5Z8B6_BCL2L11      aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
A0A2K5Z4C3_BMF-01       ---------------------------------------cgatctgtttg
A0A2K5Z4C3_BMF-02       ---------------------------------------cgatctgtttg
A0A2K5XJR2_BAD-02       ---------------------------------------c--------tg
A0A2K5XJR2_BAD-01       ---------------------------------------c--------tg
A0A2K5XJR2_BAD-03       ---------------------------------------c--------tg

A0A2K5ZWH1_PMAIP1-      cggcgagggaccaggccggatttgggattgggatgcaactgcat------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       ccccgcgcct---------------------ggcccagctctct------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
A0A2K5Z8B6_BCL2L11      caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
A0A2K5Z8B6_BCL2L11      caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
A0A2K5Z8B6_BCL2L11      caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
A0A2K5Z8B6_BCL2L11      caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
A0A2K5Z4C3_BMF-01       cccagagcctacttgactgccccctcagccgacttcagctcttc------
A0A2K5Z4C3_BMF-02       cccagagcctacttgactgccccctcagccgacttcagctcttc------
A0A2K5XJR2_BAD-02       cggcaagcat------------catcgccaggccccaggcctcc------
A0A2K5XJR2_BAD-01       cggcaagcat------------catcgccaggccccaggcctcc------
A0A2K5XJR2_BAD-03       cggcaagcat------------catcgccaggccccaggcctcc------

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       -----------------------------------------gaggtggcc
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      atgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttt
A0A2K5Z8B6_BCL2L11      atgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttt
A0A2K5Z8B6_BCL2L11      atgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttt
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      atgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttt
A0A2K5Z8B6_BCL2L11      atgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttt
A0A2K5Z8B6_BCL2L11      atgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttt
A0A2K5Z4C3_BMF-01       ------------------------------------------------cc
A0A2K5Z4C3_BMF-02       ------------------------------------------------cc
A0A2K5XJR2_BAD-02       ---------------------------------------tgtgggacgcc
A0A2K5XJR2_BAD-01       ---------------------------------------tgtgggacgcc
A0A2K5XJR2_BAD-03       ---------------------------------------tgtgggacgcc

A0A2K5ZWH1_PMAIP1-      -ttcaccagaggcaaaaagctcgtctcctcctccccacttgcccttccgc
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       atgcacagcctgggtctgg---------ctttcatctacgacca------
A0A2K5Z8B6_BCL2L11      --------acaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      --------acaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      tgacacagacaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      tgacacagacaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      tgacacagacaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      ------agacaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      tgacacagacaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      tgacacagacaggagcc------------------cagcacccatgag--
A0A2K5Z8B6_BCL2L11      tgacacagacaggagcc------------------cagcacccatgag--
A0A2K5Z4C3_BMF-01       tctcacccactgctgtggccctggccttcgacc--caccagcca------
A0A2K5Z4C3_BMF-02       tctcacccactgctgtggccctggccttcgacc--caccagcca------
A0A2K5XJR2_BAD-02       agtcaccagcaggagcagc---------caaccagcagcagccatcatgg
A0A2K5XJR2_BAD-01       agtcaccagcaggagcagc---------caaccagcagcagccatcatgg
A0A2K5XJR2_BAD-03       agtcaccagcaggagcagc---------caaccagcagcagccatcatgg

A0A2K5ZWH1_PMAIP1-      ggggcca-------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       aggga---------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-03       agggggagcttggtattctccttcttgggaatctgaggactctgaaaatc

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       ---------------------------------------cttcctcgccc
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-03       ccagtgcaaggatgctcgcggaagcatcagcacggatgtctgccccagcc

A0A2K5ZWH1_PMAIP1-      ----------------------------------------cgaggaacaa
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       ----------------------------------------gacggacgac
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z8B6_BCL2L11      ----------------------------------------ttgtgacaaa
A0A2K5Z4C3_BMF-01       ----------------------------------------ggaagacaag
A0A2K5Z4C3_BMF-02       ----------------------------------------ggaagacaag
A0A2K5XJR2_BAD-02       g---------------------------------------aagagcgcgg
A0A2K5XJR2_BAD-01       ----------------------------------------aggcgctggg
A0A2K5XJR2_BAD-03       actgactcagaagcccaactcgcagagaatgtaaagctgaaggcgctggg

A0A2K5ZWH1_PMAIP1-      gtgcaagtagctcgaagtcgagtgtgcta----ctcaactca--------
A0A2K5ZWH1_PMAIP1-      --------agctcgaagtcgagtgtgcta----ctcaactca--------
A0A2K5XSA1_BIK-01       atcagggatgttcttagaagtttcctggatggtttcaccacc--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z8B6_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccac--------
A0A2K5Z4C3_BMF-01       gccacccagaccc----tc------ggcccagcctcccccagccaaggtg
A0A2K5Z4C3_BMF-02       gccacccagaccc----tc------ggcccagcctcccccagccaaggtg
A0A2K5XJR2_BAD-02       gc-acagcgacgcagatgc------ggcaaagctccagctggacgcgagt
A0A2K5XJR2_BAD-01       gctgtggagacccggagtc------gccacagctcctaccccgcgggga-
A0A2K5XJR2_BAD-03       gctgtggagacccggagtc------gccacagctcctaccccgcgggga-

A0A2K5ZWH1_PMAIP1-      ----ggagatttggagacaaactgaacttccggcagaaact---------
A0A2K5ZWH1_PMAIP1-      ----ggagatttggagacaaactgaacttccggcagaaact---------
A0A2K5XSA1_BIK-01       -------cttagggagaacataatgaggttctggagatccccgaatccca
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatggtagtcattctagaggatataggtgatagt
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatgga-----t-----gaggcc-----------
A0A2K5Z8B6_BCL2L11      ---------------------c-----ttccaggaggca-----------
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatggt-----t----------------------
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaat-------------------------------
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatggc-----ttccaggaggca-----------
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatggc-----ttccaggaggca-----------
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatggc-----ttccaggaggca-----------
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatggc-----ttccaggaggca-----------
A0A2K5Z8B6_BCL2L11      -----tatctcagtgcaatggc-----taactgg----------------
A0A2K5Z4C3_BMF-01       tcatgctgccttgtggggta---------actgaggaaccccagcgactc
A0A2K5Z4C3_BMF-02       tcatgctgccttgtggggta---------actgaggaaccccagcgactc
A0A2K5XJR2_BAD-02       cttccagtcctggtgggatcggaacttgggcaggggaagctccgc--ccc
A0A2K5XJR2_BAD-01       ----------cggaggaggacgaagggatggaggaggagcccagc--ccc
A0A2K5XJR2_BAD-03       ----------cggaggaggacgaagggatggaggaggagcccagc--ccc

A0A2K5ZWH1_PMAIP1-      -----tctgaatctgatagccaaactct----------------------
A0A2K5ZWH1_PMAIP1-      -----tctgaatctgatagccaaactct----------------------
A0A2K5XSA1_BIK-01       ggtcctgggtgtcccgtgaacaggtgct----------------------
A0A2K5Z8B6_BCL2L11      tcattgtttggatttatatttactggct----------------------
A0A2K5Z8B6_BCL2L11      -----actggatcct---------ccct----------------------
A0A2K5Z8B6_BCL2L11      -----ggctgaacctgcagatatgcgcc----------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      -----ggctgaacctgcagatatgcgcc----------------------
A0A2K5Z8B6_BCL2L11      -----ggctgaacctgcagatatgcgcc----------------------
A0A2K5Z8B6_BCL2L11      -----ggctgaacctgcagatatgcgcc----------------------
A0A2K5Z8B6_BCL2L11      -----ggctgaacctgcagatatgcgcc----------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z4C3_BMF-01       ttttacggcaatgctggctaccggcttcctctccctgccagtttcccggc
A0A2K5Z4C3_BMF-02       ttttacg-------------------------------------------
A0A2K5XJR2_BAD-02       ctcc-cagtgaccttcgctccacgccccgaaactccacc-----------
A0A2K5XJR2_BAD-01       tttcggggccgctcgcgctccgcgcccc------ccaac-----------
A0A2K5XJR2_BAD-03       tttcggggccgctcgcgctccgcgcccc------ccaac-----------

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z4C3_BMF-01       agtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgag
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       -------------------------------------------cgct---
A0A2K5XJR2_BAD-01       -------------------------------------------ctctggg
A0A2K5XJR2_BAD-03       -------------------------------------------ctctggg

A0A2K5ZWH1_PMAIP1-      -----------tctgctcaggaacctgactgcatcaaaaacttgcataag
A0A2K5ZWH1_PMAIP1-      -----------tctgctcaggaacctga----------------------
A0A2K5XSA1_BIK-01       ----gctgctgctggcactgctgctggcgctgctcagcgggggcctgcac
A0A2K5Z8B6_BCL2L11      tagatttgtatggccacca--------------ccacagtcaagatacag
A0A2K5Z8B6_BCL2L11      cggaattgcccttcatagggaagt---------tcagtggccgctcgaat
A0A2K5Z8B6_BCL2L11      cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
A0A2K5Z8B6_BCL2L11      -agagaaatag---------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
A0A2K5Z8B6_BCL2L11      cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
A0A2K5Z8B6_BCL2L11      cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
A0A2K5Z8B6_BCL2L11      cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z4C3_BMF-01       cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       ---ctcaccgtcctggtcg-gccatcttggatatgggcg-----------
A0A2K5XJR2_BAD-01       cagcacagcgttatggccgcgagctccggaggatgagtgacgagtttgtg
A0A2K5XJR2_BAD-03       cagcacagcgttatggccgcgagctccggaggatga--------------

A0A2K5ZWH1_PMAIP1-      gggactccaaaagagactttttctcaggaggtgcatacttcataaatttg
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       ctgctgctcaagtga-----------------------------------
A0A2K5Z8B6_BCL2L11      aacaactcaaccacaaggatttc----------tcatga-----------
A0A2K5Z8B6_BCL2L11      gcttagcatca----------------------agctaa-----------
A0A2K5Z8B6_BCL2L11      gcttactatgcaaggaggttg------------gcagaa-----------
A0A2K5Z8B6_BCL2L11      ------------aggaagttgtc----------gtgtag-----------
A0A2K5Z8B6_BCL2L11      ----------------gggtattttt-------gaataa-----------
A0A2K5Z8B6_BCL2L11      gcttactatgcaaggagggtattttt-------gaataattaccaagcag
A0A2K5Z8B6_BCL2L11      gcttactatgcaaggagggtattttt-------gaataattaccaagcag
A0A2K5Z8B6_BCL2L11      gcttactatgcaaggaggatgtcgcttccacctgattaa-----------
A0A2K5Z8B6_BCL2L11      gcttactatgcaaggaggttagag---------aaatag-----------
A0A2K5Z8B6_BCL2L11      ---------------------------------gactag-----------
A0A2K5Z4C3_BMF-01       cggctccatgtgcagcaacacca----------gcagaaccgaaatcgcg
A0A2K5Z4C3_BMF-02       ------------------cacca----------gcagaaccgaaatcgcg
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-01       gactcctttaagggacttcctcg----------cccgaagagcgcgggca
A0A2K5XJR2_BAD-03       --------------------------------------------------

A0A2K5ZWH1_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      ------------------------------------ctcctggcatcctc
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      ccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtc
A0A2K5Z8B6_BCL2L11      ccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtc
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z4C3_BMF-01       tgtggtggcagatcctcc---------------------tcttcctgcac
A0A2K5Z4C3_BMF-02       tgtggtggcagatcctcc---------------------tcttcctgcac
A0A2K5XJR2_BAD-02       ----gaagtgcttccctcaggcctcatgcaaaagaggatccgtgctgcct
A0A2K5XJR2_BAD-01       cagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcc
A0A2K5XJR2_BAD-03       --------------------------------------------------

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      cacctga-------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      cgcctggtgtggagaatgcattga--------------------------
A0A2K5Z8B6_BCL2L11      cgcctggtgtggagaatgcattga--------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5Z4C3_BMF-01       aaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtg
A0A2K5Z4C3_BMF-02       aaccttgctttgaatggagaagagaacaggaacggggcgggccctag---
A0A2K5XJR2_BAD-02       ctttcgg---------tgggaggg---ctgacccagattcccttccggtg
A0A2K5XJR2_BAD-01       tggtgggatcggaacttgggcagg---ggaagctccgccccctcccagtg
A0A2K5XJR2_BAD-03       --------------------------------------------------

A0A2K5ZWH1_PMAIP1-      -------
A0A2K5ZWH1_PMAIP1-      -------
A0A2K5XSA1_BIK-01       -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z8B6_BCL2L11      -------
A0A2K5Z4C3_BMF-01       a------
A0A2K5Z4C3_BMF-02       -------
A0A2K5XJR2_BAD-02       catgtga
A0A2K5XJR2_BAD-01       a------
A0A2K5XJR2_BAD-03       -------

© 1998-2019