Dataset for CDS BAD of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5XJR2_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5XJR2_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5XJR2_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc

A0A2K5XJR2_BAD-02      tgcagagaggggcctgggccccagcctcgcgggggacaggccctcagact
A0A2K5XJR2_BAD-01      tgcagagaggggcctgggccccagcctcgcgggggacaggccctcagact
A0A2K5XJR2_BAD-03      tgcagagaggggcctgggccccagcctcgcgggggacaggccctcagact

A0A2K5XJR2_BAD-02      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5XJR2_BAD-01      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5XJR2_BAD-03      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2K5XJR2_BAD-02      cagcaggagcagccaaccagcagcagccatcatggaggga----------
A0A2K5XJR2_BAD-01      cagcaggagcagccaaccagcagcagccatcatgg---------------
A0A2K5XJR2_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggggagcttggta

A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc

A0A2K5XJR2_BAD-02      ------------------------cttcctcgcccg--------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc

A0A2K5XJR2_BAD-02      -------------------------aagagcgcgggc-acagcgacgcag
A0A2K5XJR2_BAD-01      -------------------------aggcgctggggctgtggagacccgg
A0A2K5XJR2_BAD-03      caactcgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
                                                * * **  ****    * *** * *

A0A2K5XJR2_BAD-02      atgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcg
A0A2K5XJR2_BAD-01      agtcgccacagctcctaccccgcgggga-----------cggaggaggac
A0A2K5XJR2_BAD-03      agtcgccacagctcctaccccgcgggga-----------cggaggaggac
                       *  ** ** ******  *    ** *              ** **     

A0A2K5XJR2_BAD-02      gaacttgggcaggggaagctccgccccctcc-cagtgaccttcgctccac
A0A2K5XJR2_BAD-01      gaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgc
A0A2K5XJR2_BAD-03      gaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgc
                       ***     * *** * *** * ***** * *   *   *   ****** *

A0A2K5XJR2_BAD-02      gccccgaaactccacccgct------ctcaccgtcctggtcg-gccatct
A0A2K5XJR2_BAD-01      gcccc------ccaacctctgggcagcacagcgttatggccgcgagctcc
A0A2K5XJR2_BAD-03      gcccc------ccaacctctgggcagcacagcgttatggccgcgagctcc
                       *****      *** ** **      * ** ***  *** ** *   ** 

A0A2K5XJR2_BAD-02      tggatatgggcg--------------------------------------
A0A2K5XJR2_BAD-01      ggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccg
A0A2K5XJR2_BAD-03      ggaggatga-----------------------------------------
                        *   ***                                          

A0A2K5XJR2_BAD-02      -----------------gaagtgcttccctcaggcctcatgcaaaagagg
A0A2K5XJR2_BAD-01      aagagcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcg
A0A2K5XJR2_BAD-03      --------------------------------------------------

A0A2K5XJR2_BAD-02      atccgtgctgcctctttcgg---------tgggagggctgacccagattc
A0A2K5XJR2_BAD-01      agtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccc
A0A2K5XJR2_BAD-03      --------------------------------------------------

A0A2K5XJR2_BAD-02      ccttccggtgcatgtga
A0A2K5XJR2_BAD-01      cctcccagtga------
A0A2K5XJR2_BAD-03      -----------------

© 1998-2019