Dataset for CDS PMAIP1 of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6BV75_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggc
A0A2K6BV75_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggc

A0A2K6BV75_PMAIP1-      tcaggcaggaccggcagggacggcagggacggcgagggaccaggccggat
A0A2K6BV75_PMAIP1-      tcaggcag------------------------------------------

A0A2K6BV75_PMAIP1-      ttgggattgggatgcagctgcattacaccagaggcaaaaagctcgtctcc
A0A2K6BV75_PMAIP1-      --------------------------------------------------

A0A2K6BV75_PMAIP1-      tcctccccacttgtccttccgcggggccacgaggaacaagtgcaagtagc
A0A2K6BV75_PMAIP1-      -----------------------------------------------agc

A0A2K6BV75_PMAIP1-      tcgaagtcgagtgtgctactcaactcaggagatttggagacaaactaaac
A0A2K6BV75_PMAIP1-      tcgaagtcgagtgtgctactcaactcaggagatttggagacaaactaaac

A0A2K6BV75_PMAIP1-      ttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaac
A0A2K6BV75_PMAIP1-      ttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaac

A0A2K6BV75_PMAIP1-      ctgactgcatcaaaaacttgcataaggggactccaaaagagactttttct
A0A2K6BV75_PMAIP1-      ctga----------------------------------------------

A0A2K6BV75_PMAIP1-      caggaggtgcacacttcatcaatttgaagaaagattgcattgtaattgg
A0A2K6BV75_PMAIP1-      -------------------------------------------------

© 1998-2019